Incidental Mutation 'R6691:Zfp354c'
ID530426
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Namezinc finger protein 354C
SynonymsAJ18, Kid3, 5330421P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50811086-50827724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50814775 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 491 (I491T)
Ref Sequence ENSEMBL: ENSMUSP00000104763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000109135]
Predicted Effect probably benign
Transcript: ENSMUST00000000632
AA Change: I491T

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807
AA Change: I491T

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109135
AA Change: I491T

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807
AA Change: I491T

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139465
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50815613 missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50817905 missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50817194 missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50815630 missense probably benign 0.12
R1370:Zfp354c UTSW 11 50815840 missense probably benign
R2109:Zfp354c UTSW 11 50817142 missense probably benign 0.01
R2850:Zfp354c UTSW 11 50815331 nonsense probably null
R4010:Zfp354c UTSW 11 50814944 missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50815039 missense probably benign 0.14
R5430:Zfp354c UTSW 11 50815195 missense probably benign 0.02
R5439:Zfp354c UTSW 11 50815770 missense probably benign 0.01
R5905:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R6244:Zfp354c UTSW 11 50814971 missense probably benign 0.41
R6264:Zfp354c UTSW 11 50815447 missense probably benign 0.00
R6591:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R6650:Zfp354c UTSW 11 50814691 missense probably damaging 1.00
R7087:Zfp354c UTSW 11 50815213 missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50814656 missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTCTCAGGCTTGTCTCC -3'
(R):5'- GGAGAACCTTTACACGTGTGTC -3'

Sequencing Primer
(F):5'- AGGCTTGTCTCCTTTCAGAAATTTC -3'
(R):5'- GTGGGAAGACTTTCAACCAGTATTC -3'
Posted On2018-08-01