Incidental Mutation 'R6691:Amn'
ID530428
Institutional Source Beutler Lab
Gene Symbol Amn
Ensembl Gene ENSMUSG00000021278
Gene Nameamnionless
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6691 (G1)
Quality Score90.0077
Status Not validated
Chromosome12
Chromosomal Location111271095-111276426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111275397 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 299 (H299R)
Ref Sequence ENSEMBL: ENSMUSP00000021707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021707]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021707
AA Change: H299R

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021707
Gene: ENSMUSG00000021278
AA Change: H299R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Amnionless 21 451 6.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220903
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein. The encoded protein is an essential component of the cubulin receptor complex which is thought to play a role in coordinating growth and patterning of the embryo. This protein is thought to modulate a bone morphogenetic protein (BMP) signaling pathway. A homoygous mutation in the mouse gene results in the lack of an amnion in embryos. Mutations in the human gene are associated with Megaloblastic Anemia-1. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth arrest between the mid and late streak stages of gastrulation and abnormal ectoderm formation, followed by death. Generation of middle primitive streak derivatives is impaired, leading to absence of mesoderm and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Amn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Amn APN 12 111271793 missense probably damaging 0.97
IGL02397:Amn APN 12 111274479 missense possibly damaging 0.77
IGL02962:Amn APN 12 111274517 missense probably damaging 1.00
IGL02974:Amn APN 12 111271141 missense probably benign 0.01
IGL02837:Amn UTSW 12 111271899 missense possibly damaging 0.74
R0357:Amn UTSW 12 111274141 critical splice acceptor site probably null
R1986:Amn UTSW 12 111274997 missense probably damaging 1.00
R1993:Amn UTSW 12 111276092 missense probably damaging 1.00
R2355:Amn UTSW 12 111271812 missense probably damaging 0.99
R3924:Amn UTSW 12 111275680 missense possibly damaging 0.71
R3925:Amn UTSW 12 111275680 missense possibly damaging 0.71
R4364:Amn UTSW 12 111271762 missense probably damaging 0.99
R4687:Amn UTSW 12 111276068 missense probably benign 0.35
R6176:Amn UTSW 12 111274156 missense possibly damaging 0.55
R6209:Amn UTSW 12 111275411 missense probably damaging 0.99
R6300:Amn UTSW 12 111274189 missense probably benign 0.16
R6591:Amn UTSW 12 111275397 missense possibly damaging 0.77
X0025:Amn UTSW 12 111275399 missense probably damaging 1.00
Z1088:Amn UTSW 12 111275683 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATTTGACCTGGAGCGGTAC -3'
(R):5'- CTCTGAGTCTGCCGTCATAG -3'

Sequencing Primer
(F):5'- CTGCTGGACCTCTTCCTGAAG -3'
(R):5'- TCATAGGCTTGCCGGACTG -3'
Posted On2018-08-01