Mutagenetix > Incidental Mutation

Incidental Mutation 'R6741:Rptor'

530462

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

Rap, raptor, 4932417H02Rik

MMRRC Submission

044858-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6741 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119493731-119790402 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 119786803 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1256 (L1256R)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026671
AA Change: L1256R

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: L1256R

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136662

SMART Domains

Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Meta Mutation Damage Score

0.8658

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actrt3	A	C	3: 30,652,663 (GRCm39)	F144V	possibly damaging	Het
Arhgef12	A	G	9: 42,883,503 (GRCm39)	I1342T	probably benign	Het
Dbn1	A	G	13: 55,629,350 (GRCm39)		probably null	Het
Defb12	T	C	8: 19,164,757 (GRCm39)	E27G	probably benign	Het
Dennd2b	A	G	7: 109,144,304 (GRCm39)	Y534H	possibly damaging	Het
Dthd1	A	T	5: 63,000,289 (GRCm39)	H537L	probably damaging	Het
Ep400	A	T	5: 110,824,761 (GRCm39)	S2359T	unknown	Het
Epha5	T	C	5: 84,254,557 (GRCm39)	I572V	possibly damaging	Het
Grb10	C	A	11: 11,886,717 (GRCm39)		probably null	Het
Hectd2	T	C	19: 36,589,759 (GRCm39)	I628T	probably damaging	Het
Il17rb	T	A	14: 29,722,293 (GRCm39)	Q246L	possibly damaging	Het
Knop1	C	T	7: 118,445,061 (GRCm39)	R301Q	possibly damaging	Het
Lrp1b	T	C	2: 41,136,001 (GRCm39)	I1770M	possibly damaging	Het
Mgst1	A	C	6: 138,127,836 (GRCm39)	D66A	probably damaging	Het
Nags	A	G	11: 102,037,718 (GRCm39)	D237G	possibly damaging	Het
Nfatc2ip	T	A	7: 125,995,182 (GRCm39)	Q122L	possibly damaging	Het
Nod2	T	C	8: 89,379,694 (GRCm39)	V72A	probably damaging	Het
Notch3	G	T	17: 32,362,458 (GRCm39)	P1389Q	probably benign	Het
Or5ac25	A	G	16: 59,181,918 (GRCm39)	L221P	probably damaging	Het
Plekhn1	A	T	4: 156,306,249 (GRCm39)	I607N	probably damaging	Het
Plekho2	C	A	9: 65,471,197 (GRCm39)	R84L	probably damaging	Het
Prag1	A	T	8: 36,614,434 (GRCm39)	M1329L	probably benign	Het
Prpsap2	C	T	11: 61,631,771 (GRCm39)		probably null	Het
Ptprf	A	G	4: 118,080,565 (GRCm39)	S1230P	probably benign	Het
Rigi	A	G	4: 40,211,624 (GRCm39)	I648T	probably damaging	Het
Sesn3	T	C	9: 14,231,636 (GRCm39)	I189T	possibly damaging	Het
Skic2	G	A	17: 35,064,166 (GRCm39)	R507*	probably null	Het
Slc39a4	C	T	15: 76,498,283 (GRCm39)	D385N	probably damaging	Het
Tnfsf13b	T	C	8: 10,057,314 (GRCm39)	F128S	possibly damaging	Het
Vmn1r49	A	G	6: 90,049,195 (GRCm39)	V269A	probably benign	Het
Vmn2r69	T	A	7: 85,061,724 (GRCm39)	E83D	probably benign	Het
Vmn2r76	T	C	7: 85,879,560 (GRCm39)	N247D	probably benign	Het
Zmym4	A	G	4: 126,808,878 (GRCm39)	S390P	possibly damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119,690,271 (GRCm39)	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119,781,996 (GRCm39)	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119,787,262 (GRCm39)	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119,748,279 (GRCm39)	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119,548,500 (GRCm39)	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119,737,741 (GRCm39)	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119,671,413 (GRCm39)	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119,783,438 (GRCm39)	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119,615,971 (GRCm39)	missense	probably damaging	1.00
Velocipede	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119,775,793 (GRCm39)	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119,763,193 (GRCm39)	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119,785,738 (GRCm39)	splice site	probably benign
R0219:Rptor	UTSW	11	119,712,603 (GRCm39)	intron	probably benign
R0324:Rptor	UTSW	11	119,783,467 (GRCm39)	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119,671,379 (GRCm39)	nonsense	probably null
R0718:Rptor	UTSW	11	119,763,202 (GRCm39)	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119,775,780 (GRCm39)	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119,734,569 (GRCm39)	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119,634,717 (GRCm39)	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119,671,419 (GRCm39)	nonsense	probably null
R1579:Rptor	UTSW	11	119,786,827 (GRCm39)	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119,615,887 (GRCm39)	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119,647,146 (GRCm39)	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119,615,970 (GRCm39)	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2275:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2408:Rptor	UTSW	11	119,748,277 (GRCm39)	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119,756,420 (GRCm39)	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119,747,124 (GRCm39)	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119,562,171 (GRCm39)	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119,689,666 (GRCm39)	missense	probably null	1.00
R4647:Rptor	UTSW	11	119,781,989 (GRCm39)	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119,634,708 (GRCm39)	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119,748,217 (GRCm39)	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119,712,466 (GRCm39)	intron	probably benign
R5073:Rptor	UTSW	11	119,787,305 (GRCm39)	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119,494,642 (GRCm39)	missense	probably benign
R5216:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119,713,782 (GRCm39)	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119,647,075 (GRCm39)	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119,788,268 (GRCm39)	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119,786,838 (GRCm39)	missense	probably benign	0.00
R6915:Rptor	UTSW	11	119,647,171 (GRCm39)	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119,737,762 (GRCm39)	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119,765,012 (GRCm39)	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119,763,181 (GRCm39)	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119,775,805 (GRCm39)	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119,634,779 (GRCm39)	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119,783,453 (GRCm39)	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119,748,779 (GRCm39)	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119,748,763 (GRCm39)	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119,702,812 (GRCm39)	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119,783,473 (GRCm39)	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119,783,465 (GRCm39)	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119,615,858 (GRCm39)	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119,494,751 (GRCm39)	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119,734,508 (GRCm39)	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119,777,896 (GRCm39)	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119,494,765 (GRCm39)	missense	probably benign
R9224:Rptor	UTSW	11	119,785,113 (GRCm39)	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119,702,823 (GRCm39)	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119,786,772 (GRCm39)	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119,562,152 (GRCm39)	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119,781,940 (GRCm39)	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119,777,964 (GRCm39)	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119,737,231 (GRCm39)	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119,748,692 (GRCm39)	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119,762,318 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,748,279 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,742,294 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,737,578 (GRCm39)	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119,690,145 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,647,241 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,647,062 (GRCm39)	splice site	probably null
Z0001:Rptor	UTSW	11	119,494,798 (GRCm39)	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119,787,375 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,764,977 (GRCm39)	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAACTTCTCATGGCCAGTTATG -3'
(R):5'- AGGCAGGGGAGACATCTTTTG -3'

Sequencing Primer
(F):5'- AGTTATGCCATCCTTCAGAGCCAG -3'
(R):5'- TTCATGGTAGTACAGTTACACCC -3'

Posted On

2018-08-01