Incidental Mutation 'R6741:Slc39a4'
ID530465
Institutional Source Beutler Lab
Gene Symbol Slc39a4
Ensembl Gene ENSMUSG00000063354
Gene Namesolute carrier family 39 (zinc transporter), member 4
SynonymsAWMS2, zip4, 1600025H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6741 (G1)
Quality Score194.009
Status Validated
Chromosome15
Chromosomal Location76612383-76617384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76614083 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 385 (D385N)
Ref Sequence ENSEMBL: ENSMUSP00000155442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073428] [ENSMUST00000230977]
Predicted Effect probably damaging
Transcript: ENSMUST00000073428
AA Change: D385N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073134
Gene: ENSMUSG00000063354
AA Change: D385N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
Pfam:Zip 335 652 3.5e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230317
Predicted Effect probably damaging
Transcript: ENSMUST00000230977
AA Change: D385N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5181 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic letahlity around E10. Mice heterozygous for a null allele exhibit developmental defects similar to the teratology of zinc deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A C 3: 30,598,514 F144V possibly damaging Het
Arhgef12 A G 9: 42,972,207 I1342T probably benign Het
Dbn1 A G 13: 55,481,537 probably null Het
Ddx58 A G 4: 40,211,624 I648T probably damaging Het
Defb12 T C 8: 19,114,741 E27G probably benign Het
Dthd1 A T 5: 62,842,946 H537L probably damaging Het
Ep400 A T 5: 110,676,895 S2359T unknown Het
Epha5 T C 5: 84,106,698 I572V possibly damaging Het
Grb10 C A 11: 11,936,717 probably null Het
Hectd2 T C 19: 36,612,359 I628T probably damaging Het
Il17rb T A 14: 30,000,336 Q246L possibly damaging Het
Knop1 C T 7: 118,845,838 R301Q possibly damaging Het
Lrp1b T C 2: 41,245,989 I1770M possibly damaging Het
Mgst1 A C 6: 138,150,838 D66A probably damaging Het
Nags A G 11: 102,146,892 D237G possibly damaging Het
Nfatc2ip T A 7: 126,396,010 Q122L possibly damaging Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Notch3 G T 17: 32,143,484 P1389Q probably benign Het
Olfr209 A G 16: 59,361,555 L221P probably damaging Het
Plekhn1 A T 4: 156,221,792 I607N probably damaging Het
Plekho2 C A 9: 65,563,915 R84L probably damaging Het
Prag1 A T 8: 36,147,280 M1329L probably benign Het
Prpsap2 C T 11: 61,740,945 probably null Het
Ptprf A G 4: 118,223,368 S1230P probably benign Het
Rptor T G 11: 119,895,977 L1256R possibly damaging Het
Sesn3 T C 9: 14,320,340 I189T possibly damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
St5 A G 7: 109,545,097 Y534H possibly damaging Het
Tnfsf13b T C 8: 10,007,314 F128S possibly damaging Het
Vmn1r49 A G 6: 90,072,213 V269A probably benign Het
Vmn2r69 T A 7: 85,412,516 E83D probably benign Het
Vmn2r76 T C 7: 86,230,352 N247D probably benign Het
Zmym4 A G 4: 126,915,085 S390P possibly damaging Het
Other mutations in Slc39a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Slc39a4 APN 15 76614203 missense probably damaging 1.00
IGL02597:Slc39a4 APN 15 76613624 missense probably benign
IGL02798:Slc39a4 APN 15 76615182 missense probably benign 0.04
texline UTSW 15 76614083 missense probably damaging 1.00
R0519:Slc39a4 UTSW 15 76615138 missense probably benign 0.38
R0815:Slc39a4 UTSW 15 76612639 missense probably damaging 1.00
R1502:Slc39a4 UTSW 15 76616593 missense probably benign 0.00
R1547:Slc39a4 UTSW 15 76614147 nonsense probably null
R2919:Slc39a4 UTSW 15 76616670 missense probably damaging 1.00
R4634:Slc39a4 UTSW 15 76614493 missense probably benign
R5029:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5030:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5669:Slc39a4 UTSW 15 76614163 missense probably damaging 1.00
R6020:Slc39a4 UTSW 15 76616142 missense probably benign 0.03
R6920:Slc39a4 UTSW 15 76613270 missense probably damaging 0.99
R7072:Slc39a4 UTSW 15 76613258 missense probably damaging 1.00
RF035:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF040:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF041:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF042:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF043:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF044:Slc39a4 UTSW 15 76614870 small insertion probably benign
Z1176:Slc39a4 UTSW 15 76614173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGAAGCCTCCAAGTACAGC -3'
(R):5'- TCAGTGTAGACTCACCCACAG -3'

Sequencing Primer
(F):5'- CCTCCTCATGGGTGTGACC -3'
(R):5'- CACAGGGTATCTCTATGGCTCG -3'
Posted On2018-08-01