Incidental Mutation 'R6741:Olfr209'
ID530466
Institutional Source Beutler Lab
Gene Symbol Olfr209
Ensembl Gene ENSMUSG00000095706
Gene Nameolfactory receptor 209
SynonymsMOR182-6, GA_x54KRFPKG5P-55590495-55589578
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6741 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59361160-59363993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59361555 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 221 (L221P)
Ref Sequence ENSEMBL: ENSMUSP00000147068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055868] [ENSMUST00000208246] [ENSMUST00000208875] [ENSMUST00000213779]
Predicted Effect probably damaging
Transcript: ENSMUST00000055868
AA Change: L221P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053192
Gene: ENSMUSG00000095706
AA Change: L221P

DomainStartEndE-ValueType
Pfam:7tm_4 30 304 1.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 303 1.3e-6 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208246
Predicted Effect probably damaging
Transcript: ENSMUST00000208875
AA Change: L221P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213779
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A C 3: 30,598,514 F144V possibly damaging Het
Arhgef12 A G 9: 42,972,207 I1342T probably benign Het
Dbn1 A G 13: 55,481,537 probably null Het
Ddx58 A G 4: 40,211,624 I648T probably damaging Het
Defb12 T C 8: 19,114,741 E27G probably benign Het
Dthd1 A T 5: 62,842,946 H537L probably damaging Het
Ep400 A T 5: 110,676,895 S2359T unknown Het
Epha5 T C 5: 84,106,698 I572V possibly damaging Het
Grb10 C A 11: 11,936,717 probably null Het
Hectd2 T C 19: 36,612,359 I628T probably damaging Het
Il17rb T A 14: 30,000,336 Q246L possibly damaging Het
Knop1 C T 7: 118,845,838 R301Q possibly damaging Het
Lrp1b T C 2: 41,245,989 I1770M possibly damaging Het
Mgst1 A C 6: 138,150,838 D66A probably damaging Het
Nags A G 11: 102,146,892 D237G possibly damaging Het
Nfatc2ip T A 7: 126,396,010 Q122L possibly damaging Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Notch3 G T 17: 32,143,484 P1389Q probably benign Het
Plekhn1 A T 4: 156,221,792 I607N probably damaging Het
Plekho2 C A 9: 65,563,915 R84L probably damaging Het
Prag1 A T 8: 36,147,280 M1329L probably benign Het
Prpsap2 C T 11: 61,740,945 probably null Het
Ptprf A G 4: 118,223,368 S1230P probably benign Het
Rptor T G 11: 119,895,977 L1256R possibly damaging Het
Sesn3 T C 9: 14,320,340 I189T possibly damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St5 A G 7: 109,545,097 Y534H possibly damaging Het
Tnfsf13b T C 8: 10,007,314 F128S possibly damaging Het
Vmn1r49 A G 6: 90,072,213 V269A probably benign Het
Vmn2r69 T A 7: 85,412,516 E83D probably benign Het
Vmn2r76 T C 7: 86,230,352 N247D probably benign Het
Zmym4 A G 4: 126,915,085 S390P possibly damaging Het
Other mutations in Olfr209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Olfr209 APN 16 59361835 missense probably damaging 1.00
IGL01137:Olfr209 APN 16 59361972 missense probably benign 0.01
IGL01383:Olfr209 APN 16 59361953 missense probably benign 0.10
IGL01913:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL01914:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL02125:Olfr209 APN 16 59361516 missense probably benign
IGL02414:Olfr209 APN 16 59361714 missense probably damaging 1.00
IGL02512:Olfr209 APN 16 59361808 missense possibly damaging 0.95
PIT4495001:Olfr209 UTSW 16 59361508 missense probably damaging 0.99
R0029:Olfr209 UTSW 16 59361541 missense probably benign 0.00
R0531:Olfr209 UTSW 16 59361808 missense probably damaging 0.99
R1799:Olfr209 UTSW 16 59361880 missense probably benign 0.01
R1901:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1902:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1903:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1972:Olfr209 UTSW 16 59362113 missense probably damaging 0.96
R2471:Olfr209 UTSW 16 59361581 missense possibly damaging 0.79
R5013:Olfr209 UTSW 16 59361704 missense probably damaging 1.00
R5160:Olfr209 UTSW 16 59361766 missense probably damaging 1.00
R5883:Olfr209 UTSW 16 59361715 missense probably damaging 1.00
R6272:Olfr209 UTSW 16 59361585 missense possibly damaging 0.76
R6296:Olfr209 UTSW 16 59361406 missense probably benign 0.06
R6928:Olfr209 UTSW 16 59361463 missense probably damaging 1.00
X0017:Olfr209 UTSW 16 59361639 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTTCTCAAGGCACCGATGAC -3'
(R):5'- TGGACTTCTACATGGTCTACTTCATG -3'

Sequencing Primer
(F):5'- ACCGATGACTTCTTTATTTCTGAGG -3'
(R):5'- GCACTGACCCATCTATCA -3'
Posted On2018-08-01