Mutagenetix > Incidental Mutation

Incidental Mutation 'R6742:Raph1'

530470

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R6742 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60525720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 203 (S203P)

Ref Sequence

ENSEMBL: ENSMUSP00000087763 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485] [ENSMUST00000142258]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168
AA Change: S203P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: S203P

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090293
AA Change: S203P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: S203P

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122243

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127573

SMART Domains

Protein: ENSMUSP00000114596
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
coiled coil region	295	320	N/A	INTRINSIC
RA	322	408	1e-15	SMART
PH	450	560	1.6e-13	SMART
low complexity region	581	604	N/A	INTRINSIC
low complexity region	656	661	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: S203P

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: S203P

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000142258
AA Change: S203P

SMART Domains

Protein: ENSMUSP00000120638
Gene: ENSMUSG00000026014
AA Change: S203P

Domain	Start	End	E-Value	Type
low complexity region	202	212	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,678,036	R1440G	probably benign	Het
Abca13	T	A	11: 9,328,168	L3116Q	probably damaging	Het
Adgb	G	A	10: 10,411,849	H55Y	probably damaging	Het
AI182371	G	T	2: 35,084,705		probably benign	Het
Ank3	T	C	10: 69,991,582		probably benign	Het
Ccdc127	G	T	13: 74,352,923	G20W	probably damaging	Het
Ccdc149	G	A	5: 52,405,133	Q184*	probably null	Het
Cntrob	G	A	11: 69,322,923	P14S	probably damaging	Het
Dnah11	T	C	12: 118,113,894	E1288G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evpl	T	C	11: 116,222,814	D1350G	possibly damaging	Het
Fasn	T	C	11: 120,810,453	T1990A	probably damaging	Het
Itga2	T	A	13: 114,836,525	N1166I	possibly damaging	Het
Lmtk2	T	A	5: 144,148,357	C216S	probably damaging	Het
Lrp1b	T	C	2: 41,471,120	D557G	probably benign	Het
Lrrc32	T	C	7: 98,498,832	V273A	probably benign	Het
Nlrp4f	C	T	13: 65,187,440		probably null	Het
Ntng2	T	G	2: 29,200,928	M360L	probably benign	Het
Pik3c2b	A	G	1: 133,075,821	S504G	probably benign	Het
Ppfia4	A	C	1: 134,329,171	L104R	probably damaging	Het
Rbl1	G	A	2: 157,169,998	T679I	probably benign	Het
Rnase4	G	T	14: 51,105,029	R70L	probably benign	Het
Rnf146	A	C	10: 29,347,532	D119E	probably damaging	Het
Rrp1b	A	G	17: 32,056,934	H485R	probably benign	Het
Rwdd4a	T	A	8: 47,547,963		probably null	Het
Scarf2	G	A	16: 17,806,487	C552Y	probably damaging	Het
Skiv2l	G	A	17: 34,845,190	R507*	probably null	Het
Sox10	T	C	15: 79,156,476	N127S	probably damaging	Het
Speer4a	A	T	5: 26,036,056		probably null	Het
Tars	A	T	15: 11,394,341	I70N	probably damaging	Het
Thsd7a	C	T	6: 12,408,816	V736M	probably damaging	Het
Timp3	G	A	10: 86,300,878	V9M	probably benign	Het
Tnfrsf1a	A	T	6: 125,356,948	N55Y	probably damaging	Het
Trim43a	G	A	9: 88,588,346	V402I	possibly damaging	Het
Tshz2	A	G	2: 169,883,757	D91G	probably damaging	Het
Ubac1	T	C	2: 26,005,406	D345G	possibly damaging	Het
Usp4	G	A	9: 108,374,239	V538I	possibly damaging	Het
Vmn2r19	A	T	6: 123,329,958	Y475F	possibly damaging	Het
Vmn2r87	A	T	10: 130,472,527	V614E	probably damaging	Het
Wfdc2	A	T	2: 164,562,786	T21S	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp78	A	G	7: 6,378,278	E109G	probably damaging	Het
Zfp873	C	A	10: 82,058,422	A19D	probably damaging	Het
Zfp935	T	A	13: 62,454,479	K302N	probably damaging	Het
Zfpm2	G	A	15: 41,101,718	S401N	probably benign	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCCATTTCTCTGCATTTTAAGGC -3'
(R):5'- AAACATGGCACCCTGAGAGG -3'

Sequencing Primer
(F):5'- CTGCATTTTAAGGCCAAAATAACAG -3'
(R):5'- AGAGGACCGTCATCTTCCTCTAATAG -3'

Posted On

2018-08-01