Mutagenetix > Incidental Mutation

Incidental Mutation 'R6742:Lmtk2'

530482

Institutional Source

Beutler Lab

Gene Symbol

Lmtk2

Ensembl Gene

ENSMUSG00000038970

Gene Name

lemur tyrosine kinase 2

Synonyms

AATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK

MMRRC Submission

Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Essential gene?

Possibly non essential (E-score: 0.452) question?

Stock #

R6742 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144100436-144188204 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144148357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 216 (C216S)

Ref Sequence

ENSEMBL: ENSMUSP00000048238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041804]

AlphaFold

Q3TYD6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041804
AA Change: C216S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: C216S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	42	61	N/A	INTRINSIC
low complexity region	72	88	N/A	INTRINSIC
STYKc	136	406	3.4e-39	SMART
low complexity region	924	953	N/A	INTRINSIC
low complexity region	1019	1035	N/A	INTRINSIC
low complexity region	1104	1117	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1354	1367	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,678,036	R1440G	probably benign	Het
Abca13	T	A	11: 9,328,168	L3116Q	probably damaging	Het
Adgb	G	A	10: 10,411,849	H55Y	probably damaging	Het
AI182371	G	T	2: 35,084,705		probably benign	Het
Ank3	T	C	10: 69,991,582		probably benign	Het
Ccdc127	G	T	13: 74,352,923	G20W	probably damaging	Het
Ccdc149	G	A	5: 52,405,133	Q184*	probably null	Het
Cntrob	G	A	11: 69,322,923	P14S	probably damaging	Het
Dnah11	T	C	12: 118,113,894	E1288G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evpl	T	C	11: 116,222,814	D1350G	possibly damaging	Het
Fasn	T	C	11: 120,810,453	T1990A	probably damaging	Het
Itga2	T	A	13: 114,836,525	N1166I	possibly damaging	Het
Lrp1b	T	C	2: 41,471,120	D557G	probably benign	Het
Lrrc32	T	C	7: 98,498,832	V273A	probably benign	Het
Nlrp4f	C	T	13: 65,187,440		probably null	Het
Ntng2	T	G	2: 29,200,928	M360L	probably benign	Het
Pik3c2b	A	G	1: 133,075,821	S504G	probably benign	Het
Ppfia4	A	C	1: 134,329,171	L104R	probably damaging	Het
Raph1	A	G	1: 60,525,720	S203P	probably damaging	Het
Rbl1	G	A	2: 157,169,998	T679I	probably benign	Het
Rnase4	G	T	14: 51,105,029	R70L	probably benign	Het
Rnf146	A	C	10: 29,347,532	D119E	probably damaging	Het
Rrp1b	A	G	17: 32,056,934	H485R	probably benign	Het
Rwdd4a	T	A	8: 47,547,963		probably null	Het
Scarf2	G	A	16: 17,806,487	C552Y	probably damaging	Het
Skiv2l	G	A	17: 34,845,190	R507*	probably null	Het
Sox10	T	C	15: 79,156,476	N127S	probably damaging	Het
Speer4a	A	T	5: 26,036,056		probably null	Het
Tars	A	T	15: 11,394,341	I70N	probably damaging	Het
Thsd7a	C	T	6: 12,408,816	V736M	probably damaging	Het
Timp3	G	A	10: 86,300,878	V9M	probably benign	Het
Tnfrsf1a	A	T	6: 125,356,948	N55Y	probably damaging	Het
Trim43a	G	A	9: 88,588,346	V402I	possibly damaging	Het
Tshz2	A	G	2: 169,883,757	D91G	probably damaging	Het
Ubac1	T	C	2: 26,005,406	D345G	possibly damaging	Het
Usp4	G	A	9: 108,374,239	V538I	possibly damaging	Het
Vmn2r19	A	T	6: 123,329,958	Y475F	possibly damaging	Het
Vmn2r87	A	T	10: 130,472,527	V614E	probably damaging	Het
Wfdc2	A	T	2: 164,562,786	T21S	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp78	A	G	7: 6,378,278	E109G	probably damaging	Het
Zfp873	C	A	10: 82,058,422	A19D	probably damaging	Het
Zfp935	T	A	13: 62,454,479	K302N	probably damaging	Het
Zfpm2	G	A	15: 41,101,718	S401N	probably benign	Het

Other mutations in Lmtk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmtk2	APN	5	144134155	missense	probably damaging	1.00
IGL00496:Lmtk2	APN	5	144174694	missense	probably benign
IGL00848:Lmtk2	APN	5	144176398	missense	probably benign
IGL01450:Lmtk2	APN	5	144174702	missense	probably benign	0.03
IGL01833:Lmtk2	APN	5	144175935	nonsense	probably null
IGL01967:Lmtk2	APN	5	144182779	missense	probably benign
IGL01998:Lmtk2	APN	5	144176065	missense	probably damaging	1.00
IGL02106:Lmtk2	APN	5	144175951	missense	probably benign	0.03
IGL02147:Lmtk2	APN	5	144156936	missense	possibly damaging	0.78
IGL02581:Lmtk2	APN	5	144148348	missense	probably damaging	1.00
madagascar	UTSW	5	144174919	missense	probably benign	0.02
A4554:Lmtk2	UTSW	5	144166317	missense	possibly damaging	0.82
R0039:Lmtk2	UTSW	5	144166387	missense	probably damaging	1.00
R0039:Lmtk2	UTSW	5	144166387	missense	probably damaging	1.00
R0108:Lmtk2	UTSW	5	144174285	missense	possibly damaging	0.78
R0367:Lmtk2	UTSW	5	144174285	missense	possibly damaging	0.78
R0515:Lmtk2	UTSW	5	144174991	missense	possibly damaging	0.77
R1434:Lmtk2	UTSW	5	144174589	missense	probably damaging	1.00
R1617:Lmtk2	UTSW	5	144173862	missense	probably damaging	1.00
R1760:Lmtk2	UTSW	5	144174175	missense	probably damaging	0.99
R1785:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R1786:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R1907:Lmtk2	UTSW	5	144175110	missense	probably benign	0.00
R2130:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2131:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2132:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2133:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2140:Lmtk2	UTSW	5	144147615	missense	probably damaging	1.00
R2141:Lmtk2	UTSW	5	144147615	missense	probably damaging	1.00
R2210:Lmtk2	UTSW	5	144147609	missense	probably damaging	1.00
R2289:Lmtk2	UTSW	5	144176106	missense	possibly damaging	0.80
R2312:Lmtk2	UTSW	5	144173626	missense	probably damaging	1.00
R2352:Lmtk2	UTSW	5	144173911	missense	probably benign	0.05
R3870:Lmtk2	UTSW	5	144166427	splice site	probably benign
R4011:Lmtk2	UTSW	5	144175879	missense	probably benign	0.01
R4272:Lmtk2	UTSW	5	144183226	missense	probably benign	0.05
R4361:Lmtk2	UTSW	5	144147664	missense	probably damaging	1.00
R4580:Lmtk2	UTSW	5	144174781	missense	possibly damaging	0.56
R4621:Lmtk2	UTSW	5	144174934	missense	probably benign	0.02
R4981:Lmtk2	UTSW	5	144176447	missense	probably damaging	1.00
R5818:Lmtk2	UTSW	5	144156900	missense	probably benign	0.07
R5984:Lmtk2	UTSW	5	144174838	missense	probably benign
R6083:Lmtk2	UTSW	5	144182756	missense	probably damaging	1.00
R6180:Lmtk2	UTSW	5	144175342	missense	probably damaging	1.00
R6411:Lmtk2	UTSW	5	144174586	missense	probably damaging	0.99
R6544:Lmtk2	UTSW	5	144173806	missense	possibly damaging	0.68
R6628:Lmtk2	UTSW	5	144174685	missense	probably benign	0.03
R6698:Lmtk2	UTSW	5	144174919	missense	probably benign	0.02
R6763:Lmtk2	UTSW	5	144173797	missense	probably damaging	1.00
R7286:Lmtk2	UTSW	5	144174360	nonsense	probably null
R7390:Lmtk2	UTSW	5	144129443	missense	possibly damaging	0.79
R7594:Lmtk2	UTSW	5	144173746	missense	probably damaging	1.00
R7660:Lmtk2	UTSW	5	144148340	missense	probably damaging	1.00
R7785:Lmtk2	UTSW	5	144174753	missense	probably benign	0.00
R7977:Lmtk2	UTSW	5	144175141	missense	probably benign	0.02
R7987:Lmtk2	UTSW	5	144175141	missense	probably benign	0.02
R8089:Lmtk2	UTSW	5	144156900	missense	probably benign	0.07
R8138:Lmtk2	UTSW	5	144175597	missense	probably damaging	0.99
R8694:Lmtk2	UTSW	5	144171748	missense	probably damaging	1.00
R8714:Lmtk2	UTSW	5	144176058	missense	probably damaging	1.00
R8816:Lmtk2	UTSW	5	144175975	nonsense	probably null
R8845:Lmtk2	UTSW	5	144173886	missense	probably damaging	1.00
R8856:Lmtk2	UTSW	5	144176261	missense	probably damaging	1.00
R9306:Lmtk2	UTSW	5	144182781	missense	probably benign	0.17
R9494:Lmtk2	UTSW	5	144100520	start gained	probably benign
X0024:Lmtk2	UTSW	5	144174250	missense	probably benign	0.22
Z1088:Lmtk2	UTSW	5	144182851	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- CTCGCTCTGATAGGGAAAATACAGG -3'
(R):5'- TAACGGTAACAGCTCAGCTCG -3'

Sequencing Primer
(F):5'- GAACTCTGCCTCCTTGAAGAGTG -3'
(R):5'- TAACAGCTCAGCTCGGGGTC -3'

Posted On

2018-08-01