Incidental Mutation 'R6742:A2m'
ID530484
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6742 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121678036 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1440 (R1440G)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: R1440G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: R1440G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,168 L3116Q probably damaging Het
Adgb G A 10: 10,411,849 H55Y probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,991,582 probably benign Het
Ccdc127 G T 13: 74,352,923 G20W probably damaging Het
Ccdc149 G A 5: 52,405,133 Q184* probably null Het
Cntrob G A 11: 69,322,923 P14S probably damaging Het
Dnah11 T C 12: 118,113,894 E1288G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evpl T C 11: 116,222,814 D1350G possibly damaging Het
Fasn T C 11: 120,810,453 T1990A probably damaging Het
Itga2 T A 13: 114,836,525 N1166I possibly damaging Het
Lmtk2 T A 5: 144,148,357 C216S probably damaging Het
Lrp1b T C 2: 41,471,120 D557G probably benign Het
Lrrc32 T C 7: 98,498,832 V273A probably benign Het
Nlrp4f C T 13: 65,187,440 probably null Het
Ntng2 T G 2: 29,200,928 M360L probably benign Het
Pik3c2b A G 1: 133,075,821 S504G probably benign Het
Ppfia4 A C 1: 134,329,171 L104R probably damaging Het
Raph1 A G 1: 60,525,720 S203P probably damaging Het
Rbl1 G A 2: 157,169,998 T679I probably benign Het
Rnase4 G T 14: 51,105,029 R70L probably benign Het
Rnf146 A C 10: 29,347,532 D119E probably damaging Het
Rrp1b A G 17: 32,056,934 H485R probably benign Het
Rwdd4a T A 8: 47,547,963 probably null Het
Scarf2 G A 16: 17,806,487 C552Y probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sox10 T C 15: 79,156,476 N127S probably damaging Het
Speer4a A T 5: 26,036,056 probably null Het
Tars A T 15: 11,394,341 I70N probably damaging Het
Thsd7a C T 6: 12,408,816 V736M probably damaging Het
Timp3 G A 10: 86,300,878 V9M probably benign Het
Tnfrsf1a A T 6: 125,356,948 N55Y probably damaging Het
Trim43a G A 9: 88,588,346 V402I possibly damaging Het
Tshz2 A G 2: 169,883,757 D91G probably damaging Het
Ubac1 T C 2: 26,005,406 D345G possibly damaging Het
Usp4 G A 9: 108,374,239 V538I possibly damaging Het
Vmn2r19 A T 6: 123,329,958 Y475F possibly damaging Het
Vmn2r87 A T 10: 130,472,527 V614E probably damaging Het
Wfdc2 A T 2: 164,562,786 T21S probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp78 A G 7: 6,378,278 E109G probably damaging Het
Zfp873 C A 10: 82,058,422 A19D probably damaging Het
Zfp935 T A 13: 62,454,479 K302N probably damaging Het
Zfpm2 G A 15: 41,101,718 S401N probably benign Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6795:A2m UTSW 6 121648322 splice site probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
R7013:A2m UTSW 6 121641386 missense probably null 0.00
R7137:A2m UTSW 6 121677985 missense possibly damaging 0.85
R7167:A2m UTSW 6 121647971 missense probably benign
R7294:A2m UTSW 6 121673582 nonsense probably null
R7452:A2m UTSW 6 121641332 missense probably damaging 1.00
R7507:A2m UTSW 6 121675218 missense probably benign 0.01
R7602:A2m UTSW 6 121642007 missense probably damaging 1.00
R7602:A2m UTSW 6 121670936 missense possibly damaging 0.79
R7709:A2m UTSW 6 121660104 missense possibly damaging 0.81
R7766:A2m UTSW 6 121638341 missense probably benign 0.08
R7921:A2m UTSW 6 121677995 missense probably benign 0.00
R8007:A2m UTSW 6 121670886 intron probably benign
R8291:A2m UTSW 6 121678058 missense probably damaging 1.00
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAATTTCCCACTTACTCTGG -3'
(R):5'- GGGTTTAAAATGTGCTTTCTTCCAC -3'

Sequencing Primer
(F):5'- ACTTACTCTGGGGGTTTTCTATAC -3'
(R):5'- CTTCCACAGAAGCAAGGAGATAAAG -3'
Posted On2018-08-01