Incidental Mutation 'R6742:Vmn2r19'
ID530485
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Namevomeronasal 2, receptor 19
SynonymsEG232358
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6742 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123308333-123336537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123329958 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 475 (Y475F)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073948
AA Change: Y475F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: Y475F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,036 R1440G probably benign Het
Abca13 T A 11: 9,328,168 L3116Q probably damaging Het
Adgb G A 10: 10,411,849 H55Y probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,991,582 probably benign Het
Ccdc127 G T 13: 74,352,923 G20W probably damaging Het
Ccdc149 G A 5: 52,405,133 Q184* probably null Het
Cntrob G A 11: 69,322,923 P14S probably damaging Het
Dnah11 T C 12: 118,113,894 E1288G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evpl T C 11: 116,222,814 D1350G possibly damaging Het
Fasn T C 11: 120,810,453 T1990A probably damaging Het
Itga2 T A 13: 114,836,525 N1166I possibly damaging Het
Lmtk2 T A 5: 144,148,357 C216S probably damaging Het
Lrp1b T C 2: 41,471,120 D557G probably benign Het
Lrrc32 T C 7: 98,498,832 V273A probably benign Het
Nlrp4f C T 13: 65,187,440 probably null Het
Ntng2 T G 2: 29,200,928 M360L probably benign Het
Pik3c2b A G 1: 133,075,821 S504G probably benign Het
Ppfia4 A C 1: 134,329,171 L104R probably damaging Het
Raph1 A G 1: 60,525,720 S203P probably damaging Het
Rbl1 G A 2: 157,169,998 T679I probably benign Het
Rnase4 G T 14: 51,105,029 R70L probably benign Het
Rnf146 A C 10: 29,347,532 D119E probably damaging Het
Rrp1b A G 17: 32,056,934 H485R probably benign Het
Rwdd4a T A 8: 47,547,963 probably null Het
Scarf2 G A 16: 17,806,487 C552Y probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sox10 T C 15: 79,156,476 N127S probably damaging Het
Speer4a A T 5: 26,036,056 probably null Het
Tars A T 15: 11,394,341 I70N probably damaging Het
Thsd7a C T 6: 12,408,816 V736M probably damaging Het
Timp3 G A 10: 86,300,878 V9M probably benign Het
Tnfrsf1a A T 6: 125,356,948 N55Y probably damaging Het
Trim43a G A 9: 88,588,346 V402I possibly damaging Het
Tshz2 A G 2: 169,883,757 D91G probably damaging Het
Ubac1 T C 2: 26,005,406 D345G possibly damaging Het
Usp4 G A 9: 108,374,239 V538I possibly damaging Het
Vmn2r87 A T 10: 130,472,527 V614E probably damaging Het
Wfdc2 A T 2: 164,562,786 T21S probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp78 A G 7: 6,378,278 E109G probably damaging Het
Zfp873 C A 10: 82,058,422 A19D probably damaging Het
Zfp935 T A 13: 62,454,479 K302N probably damaging Het
Zfpm2 G A 15: 41,101,718 S401N probably benign Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123335972 missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123331638 critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 unclassified probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123315628 missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123336253 missense probably benign
R6393:Vmn2r19 UTSW 6 123316153 missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R7662:Vmn2r19 UTSW 6 123331562 missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123335791 missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123316039 missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123335945 missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123336262 missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123331629 missense probably damaging 1.00
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123336077 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGATTAGCCCTATGACAAATGTTTG -3'
(R):5'- CACTCTGAGAACAGCACATGG -3'

Sequencing Primer
(F):5'- AGCCCTATGACAAATGTTTGATATAC -3'
(R):5'- CTCTGAGAACAGCACATGGTTCTG -3'
Posted On2018-08-01