Incidental Mutation 'R6742:Vmn2r19'
ID 530485
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Name vomeronasal 2, receptor 19
Synonyms EG232358
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6742 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 123308333-123336537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123329958 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 475 (Y475F)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
AlphaFold G5E8G4
Predicted Effect possibly damaging
Transcript: ENSMUST00000073948
AA Change: Y475F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: Y475F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,036 R1440G probably benign Het
Abca13 T A 11: 9,328,168 L3116Q probably damaging Het
Adgb G A 10: 10,411,849 H55Y probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,991,582 probably benign Het
Ccdc127 G T 13: 74,352,923 G20W probably damaging Het
Ccdc149 G A 5: 52,405,133 Q184* probably null Het
Cntrob G A 11: 69,322,923 P14S probably damaging Het
Dnah11 T C 12: 118,113,894 E1288G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evpl T C 11: 116,222,814 D1350G possibly damaging Het
Fasn T C 11: 120,810,453 T1990A probably damaging Het
Itga2 T A 13: 114,836,525 N1166I possibly damaging Het
Lmtk2 T A 5: 144,148,357 C216S probably damaging Het
Lrp1b T C 2: 41,471,120 D557G probably benign Het
Lrrc32 T C 7: 98,498,832 V273A probably benign Het
Nlrp4f C T 13: 65,187,440 probably null Het
Ntng2 T G 2: 29,200,928 M360L probably benign Het
Pik3c2b A G 1: 133,075,821 S504G probably benign Het
Ppfia4 A C 1: 134,329,171 L104R probably damaging Het
Raph1 A G 1: 60,525,720 S203P probably damaging Het
Rbl1 G A 2: 157,169,998 T679I probably benign Het
Rnase4 G T 14: 51,105,029 R70L probably benign Het
Rnf146 A C 10: 29,347,532 D119E probably damaging Het
Rrp1b A G 17: 32,056,934 H485R probably benign Het
Rwdd4a T A 8: 47,547,963 probably null Het
Scarf2 G A 16: 17,806,487 C552Y probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sox10 T C 15: 79,156,476 N127S probably damaging Het
Speer4a A T 5: 26,036,056 probably null Het
Tars A T 15: 11,394,341 I70N probably damaging Het
Thsd7a C T 6: 12,408,816 V736M probably damaging Het
Timp3 G A 10: 86,300,878 V9M probably benign Het
Tnfrsf1a A T 6: 125,356,948 N55Y probably damaging Het
Trim43a G A 9: 88,588,346 V402I possibly damaging Het
Tshz2 A G 2: 169,883,757 D91G probably damaging Het
Ubac1 T C 2: 26,005,406 D345G possibly damaging Het
Usp4 G A 9: 108,374,239 V538I possibly damaging Het
Vmn2r87 A T 10: 130,472,527 V614E probably damaging Het
Wfdc2 A T 2: 164,562,786 T21S probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp78 A G 7: 6,378,278 E109G probably damaging Het
Zfp873 C A 10: 82,058,422 A19D probably damaging Het
Zfp935 T A 13: 62,454,479 K302N probably damaging Het
Zfpm2 G A 15: 41,101,718 S401N probably benign Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123335972 missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123331638 critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 splice site probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123315628 missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123336253 missense probably benign
R6393:Vmn2r19 UTSW 6 123316153 missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R7662:Vmn2r19 UTSW 6 123331562 missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123335791 missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123316039 missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123335945 missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123336262 missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123331629 missense probably damaging 1.00
R8937:Vmn2r19 UTSW 6 123316324 critical splice donor site probably null
R9058:Vmn2r19 UTSW 6 123336062 missense possibly damaging 0.53
R9119:Vmn2r19 UTSW 6 123315568 missense possibly damaging 0.68
R9384:Vmn2r19 UTSW 6 123315964 missense probably benign 0.00
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123336077 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGATTAGCCCTATGACAAATGTTTG -3'
(R):5'- CACTCTGAGAACAGCACATGG -3'

Sequencing Primer
(F):5'- AGCCCTATGACAAATGTTTGATATAC -3'
(R):5'- CTCTGAGAACAGCACATGGTTCTG -3'
Posted On 2018-08-01