Mutagenetix > Incidental Mutation

Incidental Mutation 'R6742:Eml2'

530488

Institutional Source

Beutler Lab

Gene Symbol

Eml2

Ensembl Gene

ENSMUSG00000040811

Gene Name

echinoderm microtubule associated protein like 2

Synonyms

1600029N02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6742 (G1)

Quality Score

175.009

Status

Validated

Chromosome

Chromosomal Location

19176421-19206482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19201163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 432 (V432I)

Ref Sequence

ENSEMBL: ENSMUSP00000112447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]

AlphaFold

Q7TNG5

Predicted Effect

probably damaging
Transcript: ENSMUST00000048502
AA Change: V451I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: V451I

Domain	Start	End	E-Value	Type
Pfam:HELP	17	65	4.6e-14	PFAM
WD40	113	162	8.36e-2	SMART
WD40	165	210	9.21e0	SMART
WD40	213	252	7.99e-1	SMART
WD40	258	298	3.7e0	SMART
WD40	301	341	3.58e-1	SMART
WD40	385	424	5.52e-2	SMART
WD40	427	465	1.1e1	SMART
WD40	468	507	4.95e-4	SMART
WD40	514	553	4.62e-4	SMART
WD40	579	620	4.75e1	SMART
WD40	626	666	2.67e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117338
AA Change: V624I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: V624I

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
coiled coil region	59	106	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
Pfam:HELP	211	285	3.5e-29	PFAM
WD40	286	335	5.5e-4	SMART
WD40	338	383	5.8e-2	SMART
WD40	386	425	5.2e-3	SMART
WD40	431	471	2.4e-2	SMART
WD40	474	514	2.3e-3	SMART
WD40	558	597	3.6e-4	SMART
WD40	600	638	7.1e-2	SMART
WD40	641	680	3.1e-6	SMART
WD40	687	726	3.1e-6	SMART
WD40	752	793	3e-1	SMART
WD40	799	839	1.7e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120595
AA Change: V432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: V432I

Domain	Start	End	E-Value	Type
WD40	94	154	2.48e0	SMART
WD40	157	196	7.99e-1	SMART
WD40	202	242	3.7e0	SMART
WD40	245	285	3.58e-1	SMART
WD40	329	368	5.52e-2	SMART
WD40	371	409	1.1e1	SMART
WD40	412	451	4.95e-4	SMART
WD40	458	497	4.62e-4	SMART
WD40	523	564	4.75e1	SMART
WD40	570	610	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148246

SMART Domains

Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

Domain	Start	End	E-Value	Type
WD40	94	143	8.36e-2	SMART
WD40	146	191	9.21e0	SMART
WD40	194	233	7.99e-1	SMART
WD40	239	279	3.7e0	SMART
WD40	282	322	3.58e-1	SMART
WD40	366	405	5.52e-2	SMART

Meta Mutation Damage Score

0.2533

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,678,036	R1440G	probably benign	Het
Abca13	T	A	11: 9,328,168	L3116Q	probably damaging	Het
Adgb	G	A	10: 10,411,849	H55Y	probably damaging	Het
AI182371	G	T	2: 35,084,705		probably benign	Het
Ank3	T	C	10: 69,991,582		probably benign	Het
Ccdc127	G	T	13: 74,352,923	G20W	probably damaging	Het
Ccdc149	G	A	5: 52,405,133	Q184*	probably null	Het
Cntrob	G	A	11: 69,322,923	P14S	probably damaging	Het
Dnah11	T	C	12: 118,113,894	E1288G	possibly damaging	Het
Evpl	T	C	11: 116,222,814	D1350G	possibly damaging	Het
Fasn	T	C	11: 120,810,453	T1990A	probably damaging	Het
Itga2	T	A	13: 114,836,525	N1166I	possibly damaging	Het
Lmtk2	T	A	5: 144,148,357	C216S	probably damaging	Het
Lrp1b	T	C	2: 41,471,120	D557G	probably benign	Het
Lrrc32	T	C	7: 98,498,832	V273A	probably benign	Het
Nlrp4f	C	T	13: 65,187,440		probably null	Het
Ntng2	T	G	2: 29,200,928	M360L	probably benign	Het
Pik3c2b	A	G	1: 133,075,821	S504G	probably benign	Het
Ppfia4	A	C	1: 134,329,171	L104R	probably damaging	Het
Raph1	A	G	1: 60,525,720	S203P	probably damaging	Het
Rbl1	G	A	2: 157,169,998	T679I	probably benign	Het
Rnase4	G	T	14: 51,105,029	R70L	probably benign	Het
Rnf146	A	C	10: 29,347,532	D119E	probably damaging	Het
Rrp1b	A	G	17: 32,056,934	H485R	probably benign	Het
Rwdd4a	T	A	8: 47,547,963		probably null	Het
Scarf2	G	A	16: 17,806,487	C552Y	probably damaging	Het
Skiv2l	G	A	17: 34,845,190	R507*	probably null	Het
Sox10	T	C	15: 79,156,476	N127S	probably damaging	Het
Speer4a	A	T	5: 26,036,056		probably null	Het
Tars	A	T	15: 11,394,341	I70N	probably damaging	Het
Thsd7a	C	T	6: 12,408,816	V736M	probably damaging	Het
Timp3	G	A	10: 86,300,878	V9M	probably benign	Het
Tnfrsf1a	A	T	6: 125,356,948	N55Y	probably damaging	Het
Trim43a	G	A	9: 88,588,346	V402I	possibly damaging	Het
Tshz2	A	G	2: 169,883,757	D91G	probably damaging	Het
Ubac1	T	C	2: 26,005,406	D345G	possibly damaging	Het
Usp4	G	A	9: 108,374,239	V538I	possibly damaging	Het
Vmn2r19	A	T	6: 123,329,958	Y475F	possibly damaging	Het
Vmn2r87	A	T	10: 130,472,527	V614E	probably damaging	Het
Wfdc2	A	T	2: 164,562,786	T21S	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp78	A	G	7: 6,378,278	E109G	probably damaging	Het
Zfp873	C	A	10: 82,058,422	A19D	probably damaging	Het
Zfp935	T	A	13: 62,454,479	K302N	probably damaging	Het
Zfpm2	G	A	15: 41,101,718	S401N	probably benign	Het

Other mutations in Eml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Eml2	APN	7	19206143	missense	probably damaging	1.00
IGL00786:Eml2	APN	7	19202582	missense	probably damaging	1.00
IGL01084:Eml2	APN	7	19190738	nonsense	probably null
IGL01132:Eml2	APN	7	19200539	missense	probably damaging	1.00
IGL01678:Eml2	APN	7	19186122	missense	probably benign	0.38
IGL01800:Eml2	APN	7	19201197	intron	probably benign
IGL02517:Eml2	APN	7	19206130	missense	probably damaging	1.00
IGL02607:Eml2	APN	7	19206111	missense	probably damaging	1.00
IGL02676:Eml2	APN	7	19184921	nonsense	probably null
IGL03082:Eml2	APN	7	19201877	missense	probably damaging	1.00
puffery	UTSW	7	19201163	missense	probably damaging	1.00
R0628_Eml2_697	UTSW	7	19201554	splice site	probably benign
R0040:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R0135:Eml2	UTSW	7	19203952	missense	probably damaging	1.00
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0362:Eml2	UTSW	7	19190806	splice site	probably null
R0387:Eml2	UTSW	7	19182259	splice site	probably null
R0432:Eml2	UTSW	7	19179531	nonsense	probably null
R0614:Eml2	UTSW	7	19202591	missense	probably damaging	1.00
R0628:Eml2	UTSW	7	19201554	splice site	probably benign
R1078:Eml2	UTSW	7	19179762	missense	probably benign	0.24
R1531:Eml2	UTSW	7	19196254	missense	probably damaging	1.00
R1856:Eml2	UTSW	7	19194061	missense	probably damaging	0.97
R1864:Eml2	UTSW	7	19201878	missense	probably damaging	1.00
R1937:Eml2	UTSW	7	19203964	missense	possibly damaging	0.68
R2032:Eml2	UTSW	7	19202555	missense	probably benign	0.03
R2185:Eml2	UTSW	7	19194028	missense	probably damaging	1.00
R2419:Eml2	UTSW	7	19176695	unclassified	probably benign
R3821:Eml2	UTSW	7	19202986	missense	possibly damaging	0.94
R4199:Eml2	UTSW	7	19179439	missense	probably benign	0.00
R4411:Eml2	UTSW	7	19182401	critical splice donor site	probably null
R4497:Eml2	UTSW	7	19179350	missense	probably damaging	1.00
R4885:Eml2	UTSW	7	19204010	missense	probably benign	0.05
R4912:Eml2	UTSW	7	19193999	splice site	probably null
R5028:Eml2	UTSW	7	19179447	critical splice donor site	probably null
R5192:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5196:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5373:Eml2	UTSW	7	19179263	missense	possibly damaging	0.92
R5718:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5719:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5720:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5727:Eml2	UTSW	7	19190760	missense	probably damaging	0.99
R5841:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5842:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5843:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5844:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6014:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6015:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6017:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6073:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6075:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6126:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6128:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6129:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6189:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6190:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6258:Eml2	UTSW	7	19179364	splice site	probably null
R6273:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6289:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6376:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6378:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6381:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6384:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6394:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6435:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6436:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6437:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6476:Eml2	UTSW	7	19196311	missense	probably benign	0.26
R6550:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6551:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6552:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6554:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6572:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R6598:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6599:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6704:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6705:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6709:Eml2	UTSW	7	19206211	makesense	probably null
R6730:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6734:Eml2	UTSW	7	19200507	missense	probably benign	0.35
R6769:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6770:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6864:Eml2	UTSW	7	19196281	missense	probably damaging	0.99
R6878:Eml2	UTSW	7	19200612	missense	probably benign	0.08
R7045:Eml2	UTSW	7	19201579	missense	probably damaging	1.00
R7260:Eml2	UTSW	7	19200590	missense	probably benign	0.45
R7478:Eml2	UTSW	7	19206141	nonsense	probably null
R7706:Eml2	UTSW	7	19186110	missense	possibly damaging	0.79
R7811:Eml2	UTSW	7	19186122	missense	probably benign	0.38
R8084:Eml2	UTSW	7	19181224	critical splice donor site	probably null
R8337:Eml2	UTSW	7	19196236	missense	possibly damaging	0.84
R8414:Eml2	UTSW	7	19179295	missense	probably damaging	1.00
R8868:Eml2	UTSW	7	19194063	missense	probably benign	0.03
R8934:Eml2	UTSW	7	19179813	missense	probably damaging	0.99
R9110:Eml2	UTSW	7	19191695	missense	probably benign	0.07
R9131:Eml2	UTSW	7	19184826	missense
R9144:Eml2	UTSW	7	19201639	missense	possibly damaging	0.75
R9261:Eml2	UTSW	7	19179818	missense	probably benign	0.45
R9285:Eml2	UTSW	7	19191643	missense	probably damaging	0.98
R9767:Eml2	UTSW	7	19186158	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAAATGGGGATGGCTTCTG -3'
(R):5'- CTGTGTGACAGGCTGAGATGAAC -3'

Sequencing Primer
(F):5'- CTTCTGGTGGTTTCTGTAAGGCATC -3'
(R):5'- GGATTGAAGCAGCAGGTT -3'

Posted On

2018-08-01