Incidental Mutation 'R6742:Cntrob'
ID 530500
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 044859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R6742 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69213749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 14 (P14S)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000018614
SMART Domains Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470

DomainStartEndE-ValueType
low complexity region 23 49 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:Aldo_ket_red 92 396 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092973
AA Change: P14S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: P14S

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123176
AA Change: P14S

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142328
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,654,995 (GRCm39) R1440G probably benign Het
Abca13 T A 11: 9,278,168 (GRCm39) L3116Q probably damaging Het
Adgb G A 10: 10,287,593 (GRCm39) H55Y probably damaging Het
AI182371 G T 2: 34,974,717 (GRCm39) probably benign Het
Ank3 T C 10: 69,827,412 (GRCm39) probably benign Het
Ccdc127 G T 13: 74,501,042 (GRCm39) G20W probably damaging Het
Ccdc149 G A 5: 52,562,475 (GRCm39) Q184* probably null Het
Dnah11 T C 12: 118,077,629 (GRCm39) E1288G possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Evpl T C 11: 116,113,640 (GRCm39) D1350G possibly damaging Het
Fasn T C 11: 120,701,279 (GRCm39) T1990A probably damaging Het
Itga2 T A 13: 114,973,061 (GRCm39) N1166I possibly damaging Het
Lmtk2 T A 5: 144,085,175 (GRCm39) C216S probably damaging Het
Lrp1b T C 2: 41,361,132 (GRCm39) D557G probably benign Het
Lrrc32 T C 7: 98,148,039 (GRCm39) V273A probably benign Het
Nlrp4f C T 13: 65,335,254 (GRCm39) probably null Het
Ntng2 T G 2: 29,090,940 (GRCm39) M360L probably benign Het
Pik3c2b A G 1: 133,003,559 (GRCm39) S504G probably benign Het
Ppfia4 A C 1: 134,256,909 (GRCm39) L104R probably damaging Het
Raph1 A G 1: 60,564,879 (GRCm39) S203P probably damaging Het
Rbl1 G A 2: 157,011,918 (GRCm39) T679I probably benign Het
Rnase4 G T 14: 51,342,486 (GRCm39) R70L probably benign Het
Rnf146 A C 10: 29,223,528 (GRCm39) D119E probably damaging Het
Rrp1b A G 17: 32,275,908 (GRCm39) H485R probably benign Het
Rwdd4a T A 8: 48,000,998 (GRCm39) probably null Het
Scarf2 G A 16: 17,624,351 (GRCm39) C552Y probably damaging Het
Skic2 G A 17: 35,064,166 (GRCm39) R507* probably null Het
Sox10 T C 15: 79,040,676 (GRCm39) N127S probably damaging Het
Speer4a1 A T 5: 26,241,054 (GRCm39) probably null Het
Tars1 A T 15: 11,394,427 (GRCm39) I70N probably damaging Het
Thsd7a C T 6: 12,408,815 (GRCm39) V736M probably damaging Het
Timp3 G A 10: 86,136,742 (GRCm39) V9M probably benign Het
Tnfrsf1a A T 6: 125,333,911 (GRCm39) N55Y probably damaging Het
Trim43a G A 9: 88,470,399 (GRCm39) V402I possibly damaging Het
Tshz2 A G 2: 169,725,677 (GRCm39) D91G probably damaging Het
Ubac1 T C 2: 25,895,418 (GRCm39) D345G possibly damaging Het
Usp4 G A 9: 108,251,438 (GRCm39) V538I possibly damaging Het
Vmn2r19 A T 6: 123,306,917 (GRCm39) Y475F possibly damaging Het
Vmn2r87 A T 10: 130,308,396 (GRCm39) V614E probably damaging Het
Wfdc2 A T 2: 164,404,706 (GRCm39) T21S probably benign Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zfp78 A G 7: 6,381,277 (GRCm39) E109G probably damaging Het
Zfp873 C A 10: 81,894,256 (GRCm39) A19D probably damaging Het
Zfp935 T A 13: 62,602,293 (GRCm39) K302N probably damaging Het
Zfpm2 G A 15: 40,965,114 (GRCm39) S401N probably benign Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGTTCTTGAGCCAAGCTG -3'
(R):5'- AGTCAGTGGACACTCCTCTAAC -3'

Sequencing Primer
(F):5'- CAGTTCTTGAGCCAAGCTGTCTAAG -3'
(R):5'- CCTCTAACCAGAAAGCTCATTTGTTG -3'
Posted On 2018-08-01