Mutagenetix > Incidental Mutation

Incidental Mutation 'R6742:Cntrob'

530500

Institutional Source

Beutler Lab

Gene Symbol

Cntrob

Ensembl Gene

ENSMUSG00000032782

Gene Name

centrobin, centrosomal BRCA2 interacting protein

Synonyms

Lip8, 9830165K03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R6742 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69299487-69323775 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 69322923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 14 (P14S)

Ref Sequence

ENSEMBL: ENSMUSP00000090651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]

AlphaFold

Q8CB62

Predicted Effect

probably benign
Transcript: ENSMUST00000018614

SMART Domains

Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470

Domain	Start	End	E-Value	Type
low complexity region	23	49	N/A	INTRINSIC
low complexity region	54	65	N/A	INTRINSIC
Pfam:Aldo_ket_red	92	396	1.6e-70	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000060956

SMART Domains

Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	109	2.2e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000092973
AA Change: P14S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: P14S

Domain	Start	End	E-Value	Type
coiled coil region	191	218	N/A	INTRINSIC
coiled coil region	249	557	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102601

SMART Domains

Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	137	1.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102602

SMART Domains

Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	137	1.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108662

SMART Domains

Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	127	2.2e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123176
AA Change: P14S

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140555

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142328

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176111

Predicted Effect

probably benign
Transcript: ENSMUST00000176938

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,678,036	R1440G	probably benign	Het
Abca13	T	A	11: 9,328,168	L3116Q	probably damaging	Het
Adgb	G	A	10: 10,411,849	H55Y	probably damaging	Het
AI182371	G	T	2: 35,084,705		probably benign	Het
Ank3	T	C	10: 69,991,582		probably benign	Het
Ccdc127	G	T	13: 74,352,923	G20W	probably damaging	Het
Ccdc149	G	A	5: 52,405,133	Q184*	probably null	Het
Dnah11	T	C	12: 118,113,894	E1288G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evpl	T	C	11: 116,222,814	D1350G	possibly damaging	Het
Fasn	T	C	11: 120,810,453	T1990A	probably damaging	Het
Itga2	T	A	13: 114,836,525	N1166I	possibly damaging	Het
Lmtk2	T	A	5: 144,148,357	C216S	probably damaging	Het
Lrp1b	T	C	2: 41,471,120	D557G	probably benign	Het
Lrrc32	T	C	7: 98,498,832	V273A	probably benign	Het
Nlrp4f	C	T	13: 65,187,440		probably null	Het
Ntng2	T	G	2: 29,200,928	M360L	probably benign	Het
Pik3c2b	A	G	1: 133,075,821	S504G	probably benign	Het
Ppfia4	A	C	1: 134,329,171	L104R	probably damaging	Het
Raph1	A	G	1: 60,525,720	S203P	probably damaging	Het
Rbl1	G	A	2: 157,169,998	T679I	probably benign	Het
Rnase4	G	T	14: 51,105,029	R70L	probably benign	Het
Rnf146	A	C	10: 29,347,532	D119E	probably damaging	Het
Rrp1b	A	G	17: 32,056,934	H485R	probably benign	Het
Rwdd4a	T	A	8: 47,547,963		probably null	Het
Scarf2	G	A	16: 17,806,487	C552Y	probably damaging	Het
Skiv2l	G	A	17: 34,845,190	R507*	probably null	Het
Sox10	T	C	15: 79,156,476	N127S	probably damaging	Het
Speer4a	A	T	5: 26,036,056		probably null	Het
Tars	A	T	15: 11,394,341	I70N	probably damaging	Het
Thsd7a	C	T	6: 12,408,816	V736M	probably damaging	Het
Timp3	G	A	10: 86,300,878	V9M	probably benign	Het
Tnfrsf1a	A	T	6: 125,356,948	N55Y	probably damaging	Het
Trim43a	G	A	9: 88,588,346	V402I	possibly damaging	Het
Tshz2	A	G	2: 169,883,757	D91G	probably damaging	Het
Ubac1	T	C	2: 26,005,406	D345G	possibly damaging	Het
Usp4	G	A	9: 108,374,239	V538I	possibly damaging	Het
Vmn2r19	A	T	6: 123,329,958	Y475F	possibly damaging	Het
Vmn2r87	A	T	10: 130,472,527	V614E	probably damaging	Het
Wfdc2	A	T	2: 164,562,786	T21S	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp78	A	G	7: 6,378,278	E109G	probably damaging	Het
Zfp873	C	A	10: 82,058,422	A19D	probably damaging	Het
Zfp935	T	A	13: 62,454,479	K302N	probably damaging	Het
Zfpm2	G	A	15: 41,101,718	S401N	probably benign	Het

Other mutations in Cntrob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02975:Cntrob	APN	11	69319373	missense	possibly damaging	0.66
IGL03173:Cntrob	APN	11	69310027	missense	possibly damaging	0.90
groats	UTSW	11	69309491	nonsense	probably null
BB005:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
BB015:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
R0270:Cntrob	UTSW	11	69311341	missense	possibly damaging	0.66
R0501:Cntrob	UTSW	11	69322868	missense	probably damaging	1.00
R1749:Cntrob	UTSW	11	69322874	missense	probably damaging	0.99
R1775:Cntrob	UTSW	11	69320867	missense	possibly damaging	0.90
R1900:Cntrob	UTSW	11	69308054	missense	probably benign	0.27
R1967:Cntrob	UTSW	11	69320963	missense	probably damaging	0.97
R2495:Cntrob	UTSW	11	69322923	missense	probably damaging	0.96
R3121:Cntrob	UTSW	11	69322700	nonsense	probably null
R3780:Cntrob	UTSW	11	69302882	missense	probably damaging	0.97
R4449:Cntrob	UTSW	11	69305549	missense	probably benign	0.29
R4696:Cntrob	UTSW	11	69320888	missense	probably damaging	1.00
R4841:Cntrob	UTSW	11	69315394	missense	possibly damaging	0.92
R4842:Cntrob	UTSW	11	69315394	missense	possibly damaging	0.92
R4908:Cntrob	UTSW	11	69320906	missense	probably damaging	0.97
R4982:Cntrob	UTSW	11	69311362	splice site	probably null
R5168:Cntrob	UTSW	11	69299990	missense	possibly damaging	0.66
R5187:Cntrob	UTSW	11	69321891	missense	possibly damaging	0.62
R5307:Cntrob	UTSW	11	69314750	missense	possibly damaging	0.66
R5473:Cntrob	UTSW	11	69322753	missense	possibly damaging	0.81
R5903:Cntrob	UTSW	11	69309375	missense	possibly damaging	0.83
R6643:Cntrob	UTSW	11	69311422	missense	possibly damaging	0.46
R6964:Cntrob	UTSW	11	69309491	nonsense	probably null
R7020:Cntrob	UTSW	11	69303092	critical splice donor site	probably null
R7425:Cntrob	UTSW	11	69314734	nonsense	probably null
R7928:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
R7946:Cntrob	UTSW	11	69315221	missense	possibly damaging	0.82
R8348:Cntrob	UTSW	11	69299853	missense	unknown
R8448:Cntrob	UTSW	11	69299853	missense	unknown
R8539:Cntrob	UTSW	11	69320826	missense	possibly damaging	0.94
R9259:Cntrob	UTSW	11	69320839	missense	possibly damaging	0.81
R9415:Cntrob	UTSW	11	69302915	missense	possibly damaging	0.66
R9553:Cntrob	UTSW	11	69314853	missense	probably benign	0.00
R9626:Cntrob	UTSW	11	69311341	missense	possibly damaging	0.66
R9628:Cntrob	UTSW	11	69322956	missense	possibly damaging	0.66
R9801:Cntrob	UTSW	11	69321407	missense	possibly damaging	0.82
Z1177:Cntrob	UTSW	11	69311449	missense	possibly damaging	0.66
Z1186:Cntrob	UTSW	11	69305578	missense	probably benign
Z1186:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1187:Cntrob	UTSW	11	69305578	missense	probably benign
Z1187:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1188:Cntrob	UTSW	11	69305578	missense	probably benign
Z1188:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1189:Cntrob	UTSW	11	69305578	missense	probably benign
Z1189:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1190:Cntrob	UTSW	11	69305578	missense	probably benign
Z1190:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1191:Cntrob	UTSW	11	69305578	missense	probably benign
Z1191:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1192:Cntrob	UTSW	11	69305578	missense	probably benign
Z1192:Cntrob	UTSW	11	69308056	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CTCAGTTCTTGAGCCAAGCTG -3'
(R):5'- AGTCAGTGGACACTCCTCTAAC -3'

Sequencing Primer
(F):5'- CAGTTCTTGAGCCAAGCTGTCTAAG -3'
(R):5'- CCTCTAACCAGAAAGCTCATTTGTTG -3'

Posted On

2018-08-01