Incidental Mutation 'R6742:Dnah11'
ID 530503
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, b2b1289Clo, b2b1203Clo, Dnahc11, avc4, b2b1279Clo, b2b1727Clo, lrd
MMRRC Submission 044859-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.603) question?
Stock # R6742 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 117841717-118162778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118077629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1288 (E1288G)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000084806
AA Change: E1288G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: E1288G

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,654,995 (GRCm39) R1440G probably benign Het
Abca13 T A 11: 9,278,168 (GRCm39) L3116Q probably damaging Het
Adgb G A 10: 10,287,593 (GRCm39) H55Y probably damaging Het
AI182371 G T 2: 34,974,717 (GRCm39) probably benign Het
Ank3 T C 10: 69,827,412 (GRCm39) probably benign Het
Ccdc127 G T 13: 74,501,042 (GRCm39) G20W probably damaging Het
Ccdc149 G A 5: 52,562,475 (GRCm39) Q184* probably null Het
Cntrob G A 11: 69,213,749 (GRCm39) P14S probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Evpl T C 11: 116,113,640 (GRCm39) D1350G possibly damaging Het
Fasn T C 11: 120,701,279 (GRCm39) T1990A probably damaging Het
Itga2 T A 13: 114,973,061 (GRCm39) N1166I possibly damaging Het
Lmtk2 T A 5: 144,085,175 (GRCm39) C216S probably damaging Het
Lrp1b T C 2: 41,361,132 (GRCm39) D557G probably benign Het
Lrrc32 T C 7: 98,148,039 (GRCm39) V273A probably benign Het
Nlrp4f C T 13: 65,335,254 (GRCm39) probably null Het
Ntng2 T G 2: 29,090,940 (GRCm39) M360L probably benign Het
Pik3c2b A G 1: 133,003,559 (GRCm39) S504G probably benign Het
Ppfia4 A C 1: 134,256,909 (GRCm39) L104R probably damaging Het
Raph1 A G 1: 60,564,879 (GRCm39) S203P probably damaging Het
Rbl1 G A 2: 157,011,918 (GRCm39) T679I probably benign Het
Rnase4 G T 14: 51,342,486 (GRCm39) R70L probably benign Het
Rnf146 A C 10: 29,223,528 (GRCm39) D119E probably damaging Het
Rrp1b A G 17: 32,275,908 (GRCm39) H485R probably benign Het
Rwdd4a T A 8: 48,000,998 (GRCm39) probably null Het
Scarf2 G A 16: 17,624,351 (GRCm39) C552Y probably damaging Het
Skic2 G A 17: 35,064,166 (GRCm39) R507* probably null Het
Sox10 T C 15: 79,040,676 (GRCm39) N127S probably damaging Het
Speer4a1 A T 5: 26,241,054 (GRCm39) probably null Het
Tars1 A T 15: 11,394,427 (GRCm39) I70N probably damaging Het
Thsd7a C T 6: 12,408,815 (GRCm39) V736M probably damaging Het
Timp3 G A 10: 86,136,742 (GRCm39) V9M probably benign Het
Tnfrsf1a A T 6: 125,333,911 (GRCm39) N55Y probably damaging Het
Trim43a G A 9: 88,470,399 (GRCm39) V402I possibly damaging Het
Tshz2 A G 2: 169,725,677 (GRCm39) D91G probably damaging Het
Ubac1 T C 2: 25,895,418 (GRCm39) D345G possibly damaging Het
Usp4 G A 9: 108,251,438 (GRCm39) V538I possibly damaging Het
Vmn2r19 A T 6: 123,306,917 (GRCm39) Y475F possibly damaging Het
Vmn2r87 A T 10: 130,308,396 (GRCm39) V614E probably damaging Het
Wfdc2 A T 2: 164,404,706 (GRCm39) T21S probably benign Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zfp78 A G 7: 6,381,277 (GRCm39) E109G probably damaging Het
Zfp873 C A 10: 81,894,256 (GRCm39) A19D probably damaging Het
Zfp935 T A 13: 62,602,293 (GRCm39) K302N probably damaging Het
Zfpm2 G A 15: 40,965,114 (GRCm39) S401N probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118,162,480 (GRCm39) missense probably benign 0.28
IGL00422:Dnah11 APN 12 118,031,831 (GRCm39) missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118,000,194 (GRCm39) missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118,150,657 (GRCm39) missense probably benign 0.01
IGL00687:Dnah11 APN 12 117,885,739 (GRCm39) splice site probably benign
IGL00833:Dnah11 APN 12 118,143,315 (GRCm39) missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117,874,937 (GRCm39) missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118,160,386 (GRCm39) missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118,106,669 (GRCm39) splice site probably benign
IGL01121:Dnah11 APN 12 118,014,430 (GRCm39) missense probably benign 0.02
IGL01143:Dnah11 APN 12 117,976,475 (GRCm39) missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117,946,734 (GRCm39) missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118,156,134 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118,010,991 (GRCm39) nonsense probably null
IGL01418:Dnah11 APN 12 117,951,217 (GRCm39) nonsense probably null
IGL01444:Dnah11 APN 12 117,983,967 (GRCm39) missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117,946,767 (GRCm39) missense probably benign 0.15
IGL01645:Dnah11 APN 12 118,150,733 (GRCm39) missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118,156,005 (GRCm39) splice site probably benign
IGL02104:Dnah11 APN 12 118,156,125 (GRCm39) missense probably benign
IGL02151:Dnah11 APN 12 118,023,623 (GRCm39) splice site probably benign
IGL02189:Dnah11 APN 12 118,046,314 (GRCm39) missense probably benign 0.00
IGL02417:Dnah11 APN 12 118,020,915 (GRCm39) missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118,150,637 (GRCm39) missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117,939,608 (GRCm39) splice site probably benign
IGL02474:Dnah11 APN 12 117,991,180 (GRCm39) splice site probably null
IGL02526:Dnah11 APN 12 118,143,353 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117,874,775 (GRCm39) missense probably damaging 1.00
IGL03011:Dnah11 APN 12 117,976,112 (GRCm39) missense probably benign 0.08
IGL03061:Dnah11 APN 12 117,866,856 (GRCm39) missense probably damaging 1.00
IGL03182:Dnah11 APN 12 117,994,026 (GRCm39) missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118,069,720 (GRCm39) missense probably benign
IGL03238:Dnah11 APN 12 118,073,633 (GRCm39) missense probably damaging 1.00
IGL03493:Dnah11 APN 12 117,976,533 (GRCm39) missense probably benign 0.00
P0045:Dnah11 UTSW 12 117,994,062 (GRCm39) missense probably benign
R0009:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118,090,621 (GRCm39) missense probably benign 0.05
R0172:Dnah11 UTSW 12 117,951,188 (GRCm39) missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117,946,791 (GRCm39) nonsense probably null
R0270:Dnah11 UTSW 12 118,004,748 (GRCm39) missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118,090,868 (GRCm39) missense probably benign 0.03
R0325:Dnah11 UTSW 12 117,976,074 (GRCm39) missense probably benign
R0370:Dnah11 UTSW 12 117,958,962 (GRCm39) missense probably benign
R0416:Dnah11 UTSW 12 117,874,793 (GRCm39) missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118,070,245 (GRCm39) missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably benign 0.01
R0607:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117,951,204 (GRCm39) missense probably damaging 1.00
R0635:Dnah11 UTSW 12 117,971,731 (GRCm39) missense probably damaging 1.00
R0755:Dnah11 UTSW 12 118,162,360 (GRCm39) missense probably benign 0.17
R0755:Dnah11 UTSW 12 117,918,564 (GRCm39) missense possibly damaging 0.95
R0789:Dnah11 UTSW 12 117,874,967 (GRCm39) missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0835:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0846:Dnah11 UTSW 12 117,897,585 (GRCm39) missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118,154,579 (GRCm39) nonsense probably null
R0928:Dnah11 UTSW 12 118,009,297 (GRCm39) missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118,024,142 (GRCm39) missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117,897,547 (GRCm39) missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117,936,099 (GRCm39) missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118,020,841 (GRCm39) nonsense probably null
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1500:Dnah11 UTSW 12 117,976,564 (GRCm39) splice site probably null
R1535:Dnah11 UTSW 12 117,982,465 (GRCm39) missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117,894,991 (GRCm39) missense probably benign 0.01
R1554:Dnah11 UTSW 12 118,046,234 (GRCm39) missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R1618:Dnah11 UTSW 12 117,979,200 (GRCm39) missense probably damaging 0.98
R1638:Dnah11 UTSW 12 117,979,154 (GRCm39) missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118,084,459 (GRCm39) missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117,897,580 (GRCm39) missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118,154,603 (GRCm39) missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118,160,379 (GRCm39) missense probably benign 0.32
R1728:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118,154,560 (GRCm39) missense probably benign 0.31
R1780:Dnah11 UTSW 12 117,991,293 (GRCm39) missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118,002,515 (GRCm39) missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118,027,587 (GRCm39) missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118,091,291 (GRCm39) missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118,046,203 (GRCm39) missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118,077,606 (GRCm39) missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 117,976,451 (GRCm39) missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 117,984,088 (GRCm39) missense probably damaging 1.00
R2140:Dnah11 UTSW 12 117,972,545 (GRCm39) missense probably benign 0.01
R2261:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2261:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2262:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117,850,421 (GRCm39) missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117,892,065 (GRCm39) missense probably damaging 1.00
R2410:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117,951,162 (GRCm39) nonsense probably null
R3499:Dnah11 UTSW 12 117,874,758 (GRCm39) missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3742:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3779:Dnah11 UTSW 12 118,094,448 (GRCm39) splice site probably benign
R3785:Dnah11 UTSW 12 117,981,337 (GRCm39) missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117,942,188 (GRCm39) splice site probably benign
R4014:Dnah11 UTSW 12 117,938,649 (GRCm39) missense probably benign 0.16
R4043:Dnah11 UTSW 12 117,843,678 (GRCm39) missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118,070,227 (GRCm39) missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4074:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4076:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4201:Dnah11 UTSW 12 117,930,394 (GRCm39) missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118,094,627 (GRCm39) missense probably benign 0.06
R4233:Dnah11 UTSW 12 117,880,526 (GRCm39) missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118,089,578 (GRCm39) nonsense probably null
R4430:Dnah11 UTSW 12 117,946,746 (GRCm39) missense probably benign 0.26
R4465:Dnah11 UTSW 12 117,951,186 (GRCm39) missense probably benign 0.09
R4489:Dnah11 UTSW 12 117,880,631 (GRCm39) missense probably benign 0.31
R4572:Dnah11 UTSW 12 117,973,860 (GRCm39) missense probably benign 0.00
R4574:Dnah11 UTSW 12 117,975,990 (GRCm39) critical splice donor site probably null
R4657:Dnah11 UTSW 12 118,156,162 (GRCm39) missense probably benign 0.02
R4709:Dnah11 UTSW 12 117,982,495 (GRCm39) missense probably benign 0.26
R4740:Dnah11 UTSW 12 118,084,279 (GRCm39) missense probably benign 0.28
R4803:Dnah11 UTSW 12 118,091,343 (GRCm39) missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117,958,935 (GRCm39) missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118,090,618 (GRCm39) missense probably benign 0.37
R5018:Dnah11 UTSW 12 118,094,463 (GRCm39) missense probably benign 0.00
R5071:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5074:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5080:Dnah11 UTSW 12 118,162,565 (GRCm39) start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 117,981,435 (GRCm39) missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117,918,486 (GRCm39) missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118,121,096 (GRCm39) missense probably benign 0.09
R5252:Dnah11 UTSW 12 118,089,676 (GRCm39) missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117,847,151 (GRCm39) missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118,049,415 (GRCm39) missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117,918,628 (GRCm39) missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118,049,432 (GRCm39) missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117,844,186 (GRCm39) critical splice donor site probably null
R5546:Dnah11 UTSW 12 117,939,583 (GRCm39) missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 117,982,537 (GRCm39) missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117,847,352 (GRCm39) missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118,077,642 (GRCm39) missense probably benign 0.04
R5706:Dnah11 UTSW 12 117,987,670 (GRCm39) missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118,090,841 (GRCm39) missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118,156,125 (GRCm39) missense probably benign
R5884:Dnah11 UTSW 12 118,141,269 (GRCm39) missense probably benign 0.00
R5900:Dnah11 UTSW 12 118,046,166 (GRCm39) splice site probably null
R5905:Dnah11 UTSW 12 117,918,659 (GRCm39) missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117,878,371 (GRCm39) splice site probably null
R5973:Dnah11 UTSW 12 118,074,687 (GRCm39) missense probably benign 0.02
R6024:Dnah11 UTSW 12 117,994,007 (GRCm39) missense probably benign 0.34
R6056:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign 0.03
R6075:Dnah11 UTSW 12 118,068,586 (GRCm39) missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign
R6191:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R6197:Dnah11 UTSW 12 118,143,482 (GRCm39) missense probably benign 0.03
R6262:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117,880,590 (GRCm39) missense probably benign 0.01
R6614:Dnah11 UTSW 12 117,850,411 (GRCm39) missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118,150,617 (GRCm39) splice site probably null
R6712:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118,009,381 (GRCm39) missense probably damaging 1.00
R6806:Dnah11 UTSW 12 117,951,411 (GRCm39) splice site probably null
R6895:Dnah11 UTSW 12 117,958,926 (GRCm39) missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118,070,297 (GRCm39) missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118,162,503 (GRCm39) missense probably benign
R6945:Dnah11 UTSW 12 118,024,045 (GRCm39) missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117,897,544 (GRCm39) missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118,072,679 (GRCm39) missense probably benign 0.00
R6976:Dnah11 UTSW 12 118,162,378 (GRCm39) missense probably benign 0.16
R7000:Dnah11 UTSW 12 117,981,396 (GRCm39) missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117,885,753 (GRCm39) frame shift probably null
R7101:Dnah11 UTSW 12 118,031,880 (GRCm39) missense probably benign
R7106:Dnah11 UTSW 12 117,924,884 (GRCm39) missense probably benign 0.15
R7203:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118,090,624 (GRCm39) missense probably benign 0.00
R7219:Dnah11 UTSW 12 118,004,830 (GRCm39) missense possibly damaging 0.95
R7308:Dnah11 UTSW 12 117,959,010 (GRCm39) missense probably damaging 1.00
R7361:Dnah11 UTSW 12 117,982,477 (GRCm39) missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117,951,177 (GRCm39) missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118,089,520 (GRCm39) missense probably damaging 1.00
R7399:Dnah11 UTSW 12 117,991,212 (GRCm39) missense probably benign 0.00
R7404:Dnah11 UTSW 12 118,068,543 (GRCm39) missense probably benign 0.36
R7473:Dnah11 UTSW 12 117,866,911 (GRCm39) missense probably benign 0.19
R7545:Dnah11 UTSW 12 117,894,939 (GRCm39) missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118,104,505 (GRCm39) splice site probably null
R7625:Dnah11 UTSW 12 118,160,377 (GRCm39) missense probably benign
R7761:Dnah11 UTSW 12 117,987,648 (GRCm39) missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118,004,744 (GRCm39) missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117,951,237 (GRCm39) missense probably benign 0.04
R7904:Dnah11 UTSW 12 117,867,003 (GRCm39) missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117,930,368 (GRCm39) missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117,842,284 (GRCm39) missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 117,976,181 (GRCm39) missense probably benign
R8254:Dnah11 UTSW 12 117,842,259 (GRCm39) missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 117,991,243 (GRCm39) nonsense probably null
R8272:Dnah11 UTSW 12 118,074,752 (GRCm39) missense probably benign 0.01
R8344:Dnah11 UTSW 12 118,049,466 (GRCm39) missense probably benign 0.00
R8515:Dnah11 UTSW 12 117,939,533 (GRCm39) missense probably damaging 1.00
R8528:Dnah11 UTSW 12 117,972,538 (GRCm39) missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117,842,247 (GRCm39) missense probably benign
R8676:Dnah11 UTSW 12 118,154,539 (GRCm39) missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118,049,384 (GRCm39) critical splice donor site probably null
R8773:Dnah11 UTSW 12 117,958,950 (GRCm39) missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117,874,764 (GRCm39) missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8866:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8881:Dnah11 UTSW 12 118,090,550 (GRCm39) missense probably benign 0.05
R8881:Dnah11 UTSW 12 118,077,647 (GRCm39) missense probably benign 0.00
R8920:Dnah11 UTSW 12 118,077,674 (GRCm39) missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118,091,381 (GRCm39) missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 117,987,718 (GRCm39) missense probably benign 0.36
R8962:Dnah11 UTSW 12 117,918,630 (GRCm39) missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117,916,273 (GRCm39) missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118,094,578 (GRCm39) missense probably benign 0.00
R9155:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9162:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9164:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117,894,918 (GRCm39) missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R9205:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9208:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117,951,095 (GRCm39) missense probably damaging 1.00
R9264:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R9290:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9291:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118,143,341 (GRCm39) missense probably benign 0.11
R9353:Dnah11 UTSW 12 118,143,434 (GRCm39) missense probably benign 0.00
R9375:Dnah11 UTSW 12 117,884,703 (GRCm39) missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118,141,290 (GRCm39) missense probably benign 0.00
R9392:Dnah11 UTSW 12 118,011,055 (GRCm39) nonsense probably null
R9433:Dnah11 UTSW 12 117,976,007 (GRCm39) missense probably damaging 1.00
R9511:Dnah11 UTSW 12 117,878,352 (GRCm39) missense probably damaging 1.00
R9526:Dnah11 UTSW 12 118,150,711 (GRCm39) missense probably damaging 0.98
R9566:Dnah11 UTSW 12 117,938,728 (GRCm39) missense possibly damaging 0.69
R9673:Dnah11 UTSW 12 117,982,513 (GRCm39) missense possibly damaging 0.91
R9705:Dnah11 UTSW 12 118,094,770 (GRCm39) missense probably damaging 1.00
R9716:Dnah11 UTSW 12 118,024,148 (GRCm39) missense probably damaging 0.99
R9746:Dnah11 UTSW 12 117,842,311 (GRCm39) nonsense probably null
R9764:Dnah11 UTSW 12 117,884,704 (GRCm39) missense probably benign 0.05
RF023:Dnah11 UTSW 12 117,918,585 (GRCm39) missense probably damaging 1.00
RF047:Dnah11 UTSW 12 117,973,818 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,858,747 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,946,704 (GRCm39) missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 118,094,534 (GRCm39) missense probably damaging 0.97
Z1176:Dnah11 UTSW 12 118,090,854 (GRCm39) missense probably benign 0.00
Z1176:Dnah11 UTSW 12 117,894,912 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTGGAGTGAAATCTAATCTGTGC -3'
(R):5'- AGCCCAGCTGCTTAATGAAAC -3'

Sequencing Primer
(F):5'- GGAGTGAAATCTAATCTGTGCATATG -3'
(R):5'- CCAGCTGCTTAATGAAACTAAGAAG -3'
Posted On 2018-08-01