Incidental Mutation 'R6742:Tars1'
ID 530509
Institutional Source Beutler Lab
Gene Symbol Tars1
Ensembl Gene ENSMUSG00000022241
Gene Name threonyl-tRNA synthetase 1
Synonyms D15Wsu59e, Tars, ThrRS
MMRRC Submission 044859-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R6742 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11383749-11399744 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11394427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 70 (I70N)
Ref Sequence ENSEMBL: ENSMUSP00000153826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]
AlphaFold Q9D0R2
Predicted Effect probably benign
Transcript: ENSMUST00000022849
AA Change: I70N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: I70N

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Pfam:TGS 82 142 7.5e-18 PFAM
tRNA_SAD 248 297 1.91e-16 SMART
Pfam:tRNA-synt_2b 396 607 5e-38 PFAM
Pfam:HGTP_anticodon 619 710 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228207
Predicted Effect probably damaging
Transcript: ENSMUST00000228814
AA Change: I70N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1399 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,654,995 (GRCm39) R1440G probably benign Het
Abca13 T A 11: 9,278,168 (GRCm39) L3116Q probably damaging Het
Adgb G A 10: 10,287,593 (GRCm39) H55Y probably damaging Het
AI182371 G T 2: 34,974,717 (GRCm39) probably benign Het
Ank3 T C 10: 69,827,412 (GRCm39) probably benign Het
Ccdc127 G T 13: 74,501,042 (GRCm39) G20W probably damaging Het
Ccdc149 G A 5: 52,562,475 (GRCm39) Q184* probably null Het
Cntrob G A 11: 69,213,749 (GRCm39) P14S probably damaging Het
Dnah11 T C 12: 118,077,629 (GRCm39) E1288G possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Evpl T C 11: 116,113,640 (GRCm39) D1350G possibly damaging Het
Fasn T C 11: 120,701,279 (GRCm39) T1990A probably damaging Het
Itga2 T A 13: 114,973,061 (GRCm39) N1166I possibly damaging Het
Lmtk2 T A 5: 144,085,175 (GRCm39) C216S probably damaging Het
Lrp1b T C 2: 41,361,132 (GRCm39) D557G probably benign Het
Lrrc32 T C 7: 98,148,039 (GRCm39) V273A probably benign Het
Nlrp4f C T 13: 65,335,254 (GRCm39) probably null Het
Ntng2 T G 2: 29,090,940 (GRCm39) M360L probably benign Het
Pik3c2b A G 1: 133,003,559 (GRCm39) S504G probably benign Het
Ppfia4 A C 1: 134,256,909 (GRCm39) L104R probably damaging Het
Raph1 A G 1: 60,564,879 (GRCm39) S203P probably damaging Het
Rbl1 G A 2: 157,011,918 (GRCm39) T679I probably benign Het
Rnase4 G T 14: 51,342,486 (GRCm39) R70L probably benign Het
Rnf146 A C 10: 29,223,528 (GRCm39) D119E probably damaging Het
Rrp1b A G 17: 32,275,908 (GRCm39) H485R probably benign Het
Rwdd4a T A 8: 48,000,998 (GRCm39) probably null Het
Scarf2 G A 16: 17,624,351 (GRCm39) C552Y probably damaging Het
Skic2 G A 17: 35,064,166 (GRCm39) R507* probably null Het
Sox10 T C 15: 79,040,676 (GRCm39) N127S probably damaging Het
Speer4a1 A T 5: 26,241,054 (GRCm39) probably null Het
Thsd7a C T 6: 12,408,815 (GRCm39) V736M probably damaging Het
Timp3 G A 10: 86,136,742 (GRCm39) V9M probably benign Het
Tnfrsf1a A T 6: 125,333,911 (GRCm39) N55Y probably damaging Het
Trim43a G A 9: 88,470,399 (GRCm39) V402I possibly damaging Het
Tshz2 A G 2: 169,725,677 (GRCm39) D91G probably damaging Het
Ubac1 T C 2: 25,895,418 (GRCm39) D345G possibly damaging Het
Usp4 G A 9: 108,251,438 (GRCm39) V538I possibly damaging Het
Vmn2r19 A T 6: 123,306,917 (GRCm39) Y475F possibly damaging Het
Vmn2r87 A T 10: 130,308,396 (GRCm39) V614E probably damaging Het
Wfdc2 A T 2: 164,404,706 (GRCm39) T21S probably benign Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zfp78 A G 7: 6,381,277 (GRCm39) E109G probably damaging Het
Zfp873 C A 10: 81,894,256 (GRCm39) A19D probably damaging Het
Zfp935 T A 13: 62,602,293 (GRCm39) K302N probably damaging Het
Zfpm2 G A 15: 40,965,114 (GRCm39) S401N probably benign Het
Other mutations in Tars1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Tars1 APN 15 11,388,307 (GRCm39) splice site probably null
IGL00642:Tars1 APN 15 11,394,458 (GRCm39) missense probably damaging 1.00
IGL01315:Tars1 APN 15 11,389,820 (GRCm39) nonsense probably null
IGL01459:Tars1 APN 15 11,391,940 (GRCm39) missense possibly damaging 0.76
IGL02141:Tars1 APN 15 11,391,280 (GRCm39) missense probably damaging 0.96
IGL03292:Tars1 APN 15 11,384,107 (GRCm39) missense probably benign 0.22
R0383:Tars1 UTSW 15 11,390,411 (GRCm39) missense probably benign
R0517:Tars1 UTSW 15 11,394,452 (GRCm39) nonsense probably null
R0685:Tars1 UTSW 15 11,385,259 (GRCm39) missense probably benign
R1589:Tars1 UTSW 15 11,388,261 (GRCm39) missense probably benign 0.32
R1753:Tars1 UTSW 15 11,394,329 (GRCm39) nonsense probably null
R2051:Tars1 UTSW 15 11,393,280 (GRCm39) nonsense probably null
R2060:Tars1 UTSW 15 11,394,459 (GRCm39) missense probably benign 0.03
R2216:Tars1 UTSW 15 11,389,794 (GRCm39) missense probably benign 0.00
R3610:Tars1 UTSW 15 11,392,990 (GRCm39) missense probably damaging 0.99
R4656:Tars1 UTSW 15 11,394,350 (GRCm39) missense probably damaging 1.00
R4844:Tars1 UTSW 15 11,385,281 (GRCm39) missense possibly damaging 0.85
R4974:Tars1 UTSW 15 11,390,477 (GRCm39) missense probably damaging 1.00
R5551:Tars1 UTSW 15 11,392,068 (GRCm39) missense probably damaging 0.97
R5992:Tars1 UTSW 15 11,397,282 (GRCm39) missense probably damaging 1.00
R6778:Tars1 UTSW 15 11,389,785 (GRCm39) missense probably benign 0.06
R6850:Tars1 UTSW 15 11,392,885 (GRCm39) missense probably benign
R7270:Tars1 UTSW 15 11,392,105 (GRCm39) missense probably benign 0.00
R7401:Tars1 UTSW 15 11,392,095 (GRCm39) nonsense probably null
R7743:Tars1 UTSW 15 11,399,458 (GRCm39) splice site probably null
R8062:Tars1 UTSW 15 11,388,400 (GRCm39) missense possibly damaging 0.78
R8852:Tars1 UTSW 15 11,393,348 (GRCm39) missense probably benign 0.02
R8942:Tars1 UTSW 15 11,384,183 (GRCm39) missense probably benign 0.27
R9205:Tars1 UTSW 15 11,397,265 (GRCm39) critical splice donor site probably null
R9362:Tars1 UTSW 15 11,387,616 (GRCm39) missense probably damaging 1.00
R9668:Tars1 UTSW 15 11,394,446 (GRCm39) nonsense probably null
Z1088:Tars1 UTSW 15 11,391,970 (GRCm39) missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ATCAGGATGTGCTGGCATGAC -3'
(R):5'- AGATCAATGCCAGTGACCATTG -3'

Sequencing Primer
(F):5'- GACAATGCATGTTTAGTTACTTTAGG -3'
(R):5'- CAATGCCAGTGACCATTGTGATCTG -3'
Posted On 2018-08-01