Mutagenetix > Incidental Mutations

Incidental Mutation 'R6745:Pla2g4a'

530517

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4a

Ensembl Gene

ENSMUSG00000056220

Gene Name

phospholipase A2, group IVA (cytosolic, calcium-dependent)

Synonyms

Type IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R6745 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149829618-149961290 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 149886230 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 151 (Q151K)

Ref Sequence

ENSEMBL: ENSMUSP00000107557 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926] [ENSMUST00000190507]

Predicted Effect

probably benign
Transcript: ENSMUST00000070200
AA Change: Q159K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: Q159K

Domain	Start	End	E-Value	Type
C2	19	121	8.23e-17	SMART
PLAc	117	668	N/A	SMART
Blast:PLAc	706	748	3e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111926
AA Change: Q151K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: Q151K

Domain	Start	End	E-Value	Type
C2	11	113	8.23e-17	SMART
PLAc	109	660	N/A	SMART
Blast:PLAc	698	740	3e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155438

Predicted Effect

probably benign
Transcript: ENSMUST00000190507
AA Change: Q121K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000139851
Gene: ENSMUSG00000056220
AA Change: Q121K

Domain	Start	End	E-Value	Type
C2	5	83	7.1e-10	SMART
Blast:PLAc	89	149	5e-32	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	G	T	10: 10,390,197	T1040K	probably damaging	Het
Adgrf3	A	G	5: 30,203,603	V59A	probably benign	Het
Ankk1	G	T	9: 49,416,180	H566Q	probably benign	Het
Avil	A	C	10: 127,014,119	D613A	probably benign	Het
Bbs9	A	G	9: 22,670,836	N613S	probably benign	Het
Chd1	A	G	17: 17,387,167	T326A	probably benign	Het
Clasp2	A	T	9: 113,875,270	R558*	probably null	Het
Cmbl	A	G	15: 31,589,787	D221G	possibly damaging	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Creb5	A	T	6: 53,604,532	M172L	probably benign	Het
Crybg3	A	G	16: 59,552,244	V2291A	possibly damaging	Het
Cyp2g1	T	G	7: 26,814,179	V181G	probably damaging	Het
D430042O09Rik	T	C	7: 125,770,650	S137P	probably benign	Het
Dclk1	T	A	3: 55,477,808	S40T	probably damaging	Het
Dnah10	G	T	5: 124,808,812	M3053I	probably damaging	Het
Dnah12	T	A	14: 26,707,228	I268K	probably damaging	Het
Dock2	C	G	11: 34,705,842	D396H	probably damaging	Het
Dock2	T	A	11: 34,705,843	K395N	probably damaging	Het
Gpbp1	G	A	13: 111,453,385	R59C	probably benign	Het
Ifi47	T	G	11: 49,095,502	I32S	probably benign	Het
Ighg3	A	G	12: 113,360,270	V166A	unknown	Het
Kdm5d	T	A	Y: 927,112	C617S	probably benign	Homo
Kif20b	T	G	19: 34,928,876	S55A	possibly damaging	Het
Klhl1	C	T	14: 96,280,002		probably null	Het
Kndc1	C	T	7: 139,920,976	T727I	probably benign	Het
Lrrk1	A	T	7: 66,273,001	I298N	probably damaging	Het
Ly75	C	A	2: 60,308,179	R1448L	probably damaging	Het
Mup4	C	T	4: 59,960,091	V58M	possibly damaging	Het
Nr2c1	T	C	10: 94,190,664	F467S	probably damaging	Het
Olfr112	T	A	17: 37,563,579	H244L	probably damaging	Het
Pom121l2	A	T	13: 21,983,698	Q713L	probably benign	Het
Pomgnt1	T	A	4: 116,153,883	S210T	probably damaging	Het
Prb1	T	C	6: 132,209,420		probably null	Het
Pyroxd2	T	C	19: 42,747,360	D101G	probably damaging	Het
Ranbp3	A	G	17: 56,709,308	D359G	probably benign	Het
Rgsl1	T	A	1: 153,822,317	I531F	probably benign	Het
Serpina1b	T	C	12: 103,730,355	N265S	possibly damaging	Het
Slc51b	T	C	9: 65,412,930	E85G	possibly damaging	Het
Stk32c	T	A	7: 139,122,893	R195W	probably damaging	Het
Uggt2	T	C	14: 119,042,610	T819A	possibly damaging	Het
Ugt1a9	A	T	1: 88,071,176	E116V	probably benign	Het
Zswim5	C	G	4: 116,975,204	P543A	probably damaging	Het

Other mutations in Pla2g4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Pla2g4a	APN	1	149886203	missense	probably benign	0.08
IGL00763:Pla2g4a	APN	1	149851325	missense	probably damaging	1.00
IGL01548:Pla2g4a	APN	1	149932656	critical splice donor site	probably null
IGL01683:Pla2g4a	APN	1	149857654	missense	probably benign	0.05
IGL01903:Pla2g4a	APN	1	149840619	missense	possibly damaging	0.51
IGL02049:Pla2g4a	APN	1	149861096	missense	probably benign	0.12
IGL02103:Pla2g4a	APN	1	149901199	missense	probably damaging	0.99
IGL03132:Pla2g4a	APN	1	149902284	splice site	probably benign
IGL03299:Pla2g4a	APN	1	149851367	missense	probably damaging	1.00
IGL03302:Pla2g4a	APN	1	149864947	missense	probably benign	0.00
R0110:Pla2g4a	UTSW	1	149840647	missense	possibly damaging	0.67
R0469:Pla2g4a	UTSW	1	149840647	missense	possibly damaging	0.67
R0488:Pla2g4a	UTSW	1	149871445	missense	probably damaging	1.00
R0606:Pla2g4a	UTSW	1	149840704	missense	probably benign	0.44
R1468:Pla2g4a	UTSW	1	149887593	splice site	probably benign
R1470:Pla2g4a	UTSW	1	149840720	missense	probably damaging	1.00
R1470:Pla2g4a	UTSW	1	149840720	missense	probably damaging	1.00
R1521:Pla2g4a	UTSW	1	149857686	critical splice acceptor site	probably null
R1718:Pla2g4a	UTSW	1	149871523	splice site	probably benign
R1778:Pla2g4a	UTSW	1	149902445	splice site	probably benign
R1967:Pla2g4a	UTSW	1	149922081	missense	probably damaging	1.00
R2063:Pla2g4a	UTSW	1	149840676	missense	possibly damaging	0.94
R2291:Pla2g4a	UTSW	1	149901189	missense	probably damaging	1.00
R3855:Pla2g4a	UTSW	1	149830177	missense	possibly damaging	0.86
R4512:Pla2g4a	UTSW	1	149861051	splice site	probably null
R4568:Pla2g4a	UTSW	1	149842226	missense	probably benign	0.43
R5266:Pla2g4a	UTSW	1	149865167	missense	possibly damaging	0.79
R5855:Pla2g4a	UTSW	1	149880063	missense	probably damaging	0.99
R5897:Pla2g4a	UTSW	1	149865148	missense	probably damaging	0.99
R6012:Pla2g4a	UTSW	1	149932677	missense	possibly damaging	0.55
R6193:Pla2g4a	UTSW	1	149902430	missense	probably damaging	1.00
R6246:Pla2g4a	UTSW	1	149872587	missense	probably damaging	1.00
R6248:Pla2g4a	UTSW	1	149872587	missense	probably damaging	1.00
R6258:Pla2g4a	UTSW	1	149857487	missense	probably benign	0.00
R6260:Pla2g4a	UTSW	1	149857487	missense	probably benign	0.00
R6293:Pla2g4a	UTSW	1	149880047	missense	probably damaging	0.98
R6310:Pla2g4a	UTSW	1	149842226	missense	possibly damaging	0.88
R6490:Pla2g4a	UTSW	1	149851335	nonsense	probably null
R6502:Pla2g4a	UTSW	1	149872616	nonsense	probably null
R6614:Pla2g4a	UTSW	1	149842235	missense	probably benign	0.07
R6671:Pla2g4a	UTSW	1	149887631	missense	probably benign
R6880:Pla2g4a	UTSW	1	149851451	missense	possibly damaging	0.90
R7058:Pla2g4a	UTSW	1	149851352	missense	probably damaging	1.00
R7163:Pla2g4a	UTSW	1	149840665	nonsense	probably null
R7422:Pla2g4a	UTSW	1	149932687	missense	probably benign	0.32
R7454:Pla2g4a	UTSW	1	149872690	missense	possibly damaging	0.63
R7474:Pla2g4a	UTSW	1	149865200	missense	possibly damaging	0.88
R7514:Pla2g4a	UTSW	1	149851362	missense	probably damaging	1.00
R7536:Pla2g4a	UTSW	1	149880017	missense	probably damaging	1.00
R7682:Pla2g4a	UTSW	1	149886271	missense	probably damaging	1.00
X0021:Pla2g4a	UTSW	1	149864926	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TCAGTTGGACCTTCCTCAAATC -3'
(R):5'- TCCTGGGAAATGGCTTGAGG -3'

Sequencing Primer
(F):5'- TGTTCCACTCCAAAAGCTGAAG -3'
(R):5'- CTTGAGGGAAGCAGTTGGC -3'

Posted On

2018-08-01