Incidental Mutation 'R6745:Rgsl1'
ID530518
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153822317 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 531 (I531F)
Ref Sequence ENSEMBL: ENSMUSP00000139340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect probably benign
Transcript: ENSMUST00000124558
AA Change: I496F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: I496F

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134030
Predicted Effect unknown
Transcript: ENSMUST00000184095
AA Change: I29F
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: I531F

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: I531F

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- ATATGCCATGCCCCACCCT -3'
(R):5'- TCCCACTGTGAAAAGCCTCT -3'

Sequencing Primer
(F):5'- ACTTGAGCCCTCTGGAAGTATAGC -3'
(R):5'- TGTGAAAAGCCTCTGCAGTC -3'
Posted On2018-08-01