Incidental Mutation 'R6745:Creb5'
ID530526
Institutional Source Beutler Lab
Gene Symbol Creb5
Ensembl Gene ENSMUSG00000053007
Gene NamecAMP responsive element binding protein 5
SynonymsCrebpa, D430026C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location53287270-53700376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53604532 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 172 (M172L)
Ref Sequence ENSEMBL: ENSMUSP00000144979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047450] [ENSMUST00000203487] [ENSMUST00000203528] [ENSMUST00000203641] [ENSMUST00000205120]
Predicted Effect probably benign
Transcript: ENSMUST00000047450
AA Change: M172L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000038532
Gene: ENSMUSG00000053007
AA Change: M172L

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203487
AA Change: M179L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144851
Gene: ENSMUSG00000053007
AA Change: M179L

DomainStartEndE-ValueType
ZnF_C2H2 16 40 7.9e-5 SMART
low complexity region 268 329 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
BRLZ 373 437 8e-23 SMART
low complexity region 455 469 N/A INTRINSIC
low complexity region 480 495 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203528
AA Change: M172L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144979
Gene: ENSMUSG00000053007
AA Change: M172L

DomainStartEndE-ValueType
ZnF_C2H2 9 33 7.9e-5 SMART
low complexity region 261 322 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
BRLZ 366 430 8e-23 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 473 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203575
Predicted Effect probably benign
Transcript: ENSMUST00000203641
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204245
Predicted Effect probably benign
Transcript: ENSMUST00000205120
AA Change: M28L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000144719
Gene: ENSMUSG00000053007
AA Change: M28L

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Creb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Creb5 APN 6 53604458 splice site probably benign
IGL02475:Creb5 APN 6 53693924 missense probably damaging 0.98
IGL02663:Creb5 APN 6 53680961 missense probably damaging 0.99
R0054:Creb5 UTSW 6 53447657 missense probably benign 0.27
R0452:Creb5 UTSW 6 53604542 missense possibly damaging 0.94
R4580:Creb5 UTSW 6 53604534 missense possibly damaging 0.46
R4809:Creb5 UTSW 6 53610426 missense probably null 0.71
R4957:Creb5 UTSW 6 53693922 critical splice acceptor site probably null
R5375:Creb5 UTSW 6 53681017 missense possibly damaging 0.79
R6552:Creb5 UTSW 6 53685384 missense probably damaging 0.99
R6616:Creb5 UTSW 6 53685310 missense possibly damaging 0.96
R6679:Creb5 UTSW 6 53685469 missense possibly damaging 0.51
R7428:Creb5 UTSW 6 53681158 missense unknown
R7581:Creb5 UTSW 6 53681237 missense probably damaging 0.99
X0065:Creb5 UTSW 6 53685401 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTCTCACATCAGAGGATC -3'
(R):5'- AGTACCCTATGCATCCTGGC -3'

Sequencing Primer
(F):5'- CACATCAGAGGATCCGATCTGTTTG -3'
(R):5'- CAAATGCATTCAGAGGCAGCTG -3'
Posted On2018-08-01