Incidental Mutation 'R6745:Stk32c'
ID 530531
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission 044862-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6745 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 138702809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 195 (R195W)
Ref Sequence ENSEMBL: ENSMUSP00000016125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect probably damaging
Transcript: ENSMUST00000016125
AA Change: R195W

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: R195W

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165870
AA Change: R77W

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981
AA Change: R77W

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Meta Mutation Damage Score 0.1837 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,265,941 (GRCm39) T1040K probably damaging Het
Adgrf3 A G 5: 30,408,601 (GRCm39) V59A probably benign Het
Ankk1 G T 9: 49,327,480 (GRCm39) H566Q probably benign Het
Avil A C 10: 126,849,988 (GRCm39) D613A probably benign Het
Bbs9 A G 9: 22,582,132 (GRCm39) N613S probably benign Het
Chd1 A G 17: 17,607,429 (GRCm39) T326A probably benign Het
Clasp2 A T 9: 113,704,338 (GRCm39) R558* probably null Het
Cmbl A G 15: 31,589,933 (GRCm39) D221G possibly damaging Het
Col3a1 G T 1: 45,377,782 (GRCm39) probably benign Het
Creb5 A T 6: 53,581,517 (GRCm39) M172L probably benign Het
Crybg3 A G 16: 59,372,607 (GRCm39) V2291A possibly damaging Het
Cyp2g1 T G 7: 26,513,604 (GRCm39) V181G probably damaging Het
Dclk1 T A 3: 55,385,229 (GRCm39) S40T probably damaging Het
Dnah10 G T 5: 124,885,876 (GRCm39) M3053I probably damaging Het
Dnah12 T A 14: 26,428,383 (GRCm39) I268K probably damaging Het
Dock2 C G 11: 34,596,669 (GRCm39) D396H probably damaging Het
Dock2 T A 11: 34,596,670 (GRCm39) K395N probably damaging Het
Gpbp1 G A 13: 111,589,919 (GRCm39) R59C probably benign Het
Ifi47 T G 11: 48,986,329 (GRCm39) I32S probably benign Het
Ighg3 A G 12: 113,323,890 (GRCm39) V166A unknown Het
Katnip T C 7: 125,369,822 (GRCm39) S137P probably benign Het
Kdm5d T A Y: 927,112 (GRCm39) C617S probably benign Homo
Kif20b T G 19: 34,906,276 (GRCm39) S55A possibly damaging Het
Klhl1 C T 14: 96,517,438 (GRCm39) probably null Het
Kndc1 C T 7: 139,500,892 (GRCm39) T727I probably benign Het
Lrrk1 A T 7: 65,922,749 (GRCm39) I298N probably damaging Het
Ly75 C A 2: 60,138,523 (GRCm39) R1448L probably damaging Het
Mup4 C T 4: 59,960,091 (GRCm39) V58M possibly damaging Het
Nr2c1 T C 10: 94,026,526 (GRCm39) F467S probably damaging Het
Or14j9 T A 17: 37,874,470 (GRCm39) H244L probably damaging Het
Pla2g4a G T 1: 149,761,981 (GRCm39) Q151K probably benign Het
Pom121l2 A T 13: 22,167,868 (GRCm39) Q713L probably benign Het
Pomgnt1 T A 4: 116,011,080 (GRCm39) S210T probably damaging Het
Prb1a T C 6: 132,186,383 (GRCm39) probably null Het
Pyroxd2 T C 19: 42,735,799 (GRCm39) D101G probably damaging Het
Ranbp3 A G 17: 57,016,308 (GRCm39) D359G probably benign Het
Rgsl1 T A 1: 153,698,063 (GRCm39) I531F probably benign Het
Serpina1b T C 12: 103,696,614 (GRCm39) N265S possibly damaging Het
Slc51b T C 9: 65,320,212 (GRCm39) E85G possibly damaging Het
Uggt2 T C 14: 119,280,022 (GRCm39) T819A possibly damaging Het
Ugt1a9 A T 1: 87,998,898 (GRCm39) E116V probably benign Het
Zswim5 C G 4: 116,832,401 (GRCm39) P543A probably damaging Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1473:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1589:Stk32c UTSW 7 138,698,931 (GRCm39) critical splice donor site probably null
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6176:Stk32c UTSW 7 138,700,691 (GRCm39) missense probably benign 0.02
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7676:Stk32c UTSW 7 138,685,220 (GRCm39) missense possibly damaging 0.87
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9117:Stk32c UTSW 7 138,768,141 (GRCm39) missense unknown
R9481:Stk32c UTSW 7 138,768,173 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CGTCCATCCTCAAAGTGGGTAG -3'
(R):5'- GCAGGATGGTGATCAGACTG -3'

Sequencing Primer
(F):5'- CATCCTCAAAGTGGGTAGTTTGGAC -3'
(R):5'- CAGGATGGTGATCAGACTGGAAGG -3'
Posted On 2018-08-01