Incidental Mutation 'R6745:Stk32c'
ID530531
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Nameserine/threonine kinase 32C
SynonymsYANK3, Pkek
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139103638-139213307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139122893 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 195 (R195W)
Ref Sequence ENSEMBL: ENSMUSP00000016125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
Predicted Effect probably damaging
Transcript: ENSMUST00000016125
AA Change: R195W

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: R195W

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165870
AA Change: R77W

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981
AA Change: R77W

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Meta Mutation Damage Score 0.1837 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 139188153 missense possibly damaging 0.47
IGL02559:Stk32c APN 7 139120690 missense probably benign 0.00
IGL02805:Stk32c APN 7 139121846 missense probably damaging 1.00
R0531:Stk32c UTSW 7 139120720 missense probably damaging 0.97
R0622:Stk32c UTSW 7 139188110 missense probably benign 0.00
R1140:Stk32c UTSW 7 139125179 missense probably damaging 0.99
R1473:Stk32c UTSW 7 139125179 missense probably damaging 0.99
R1589:Stk32c UTSW 7 139119015 critical splice donor site probably null
R1697:Stk32c UTSW 7 139121824 missense probably benign 0.25
R1855:Stk32c UTSW 7 139121447 missense probably damaging 0.97
R4290:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R4293:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R4295:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R5323:Stk32c UTSW 7 139119360 missense probably benign 0.07
R5854:Stk32c UTSW 7 139188279 intron probably benign
R5907:Stk32c UTSW 7 139120674 missense probably benign 0.32
R6115:Stk32c UTSW 7 139120712 nonsense probably null
R6117:Stk32c UTSW 7 139122923 nonsense probably null
R6176:Stk32c UTSW 7 139120775 missense probably benign 0.02
R6460:Stk32c UTSW 7 139105274 missense probably damaging 1.00
R6695:Stk32c UTSW 7 139122964 missense probably damaging 1.00
R7177:Stk32c UTSW 7 139104302 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGTCCATCCTCAAAGTGGGTAG -3'
(R):5'- GCAGGATGGTGATCAGACTG -3'

Sequencing Primer
(F):5'- CATCCTCAAAGTGGGTAGTTTGGAC -3'
(R):5'- CAGGATGGTGATCAGACTGGAAGG -3'
Posted On2018-08-01