Incidental Mutation 'R6745:Nr2c1'
ID530538
Institutional Source Beutler Lab
Gene Symbol Nr2c1
Ensembl Gene ENSMUSG00000005897
Gene Namenuclear receptor subfamily 2, group C, member 1
Synonyms4831444H07Rik, Tr2-11, Eenr, TR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location94148023-94197211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94190664 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 467 (F467S)
Ref Sequence ENSEMBL: ENSMUSP00000100927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092213] [ENSMUST00000099343] [ENSMUST00000105290]
Predicted Effect probably damaging
Transcript: ENSMUST00000092213
AA Change: F467S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089858
Gene: ENSMUSG00000005897
AA Change: F467S

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099343
AA Change: F467S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096945
Gene: ENSMUSG00000005897
AA Change: F467S

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105290
AA Change: F467S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100927
Gene: ENSMUSG00000005897
AA Change: F467S

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any defects in testis development or in spermatogenesis; no gross defects were detected in the central nervous system and normal motor neuron cell numbers were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Nr2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Nr2c1 APN 10 94190690 missense probably damaging 0.97
IGL02739:Nr2c1 APN 10 94156972 missense probably damaging 0.99
chillax UTSW 10 94163786 missense probably benign 0.38
R0077:Nr2c1 UTSW 10 94188255 missense probably benign 0.01
R0349:Nr2c1 UTSW 10 94195182 missense probably damaging 1.00
R0401:Nr2c1 UTSW 10 94171158 missense probably benign 0.02
R0418:Nr2c1 UTSW 10 94181512 missense probably benign 0.00
R0662:Nr2c1 UTSW 10 94190738 missense probably damaging 1.00
R1665:Nr2c1 UTSW 10 94188183 missense probably damaging 1.00
R1802:Nr2c1 UTSW 10 94163786 missense possibly damaging 0.95
R4812:Nr2c1 UTSW 10 94188252 missense probably benign 0.00
R5549:Nr2c1 UTSW 10 94167696 missense probably benign
R5928:Nr2c1 UTSW 10 94188193 missense probably damaging 1.00
R6219:Nr2c1 UTSW 10 94163786 missense probably benign 0.38
R6430:Nr2c1 UTSW 10 94195341 missense possibly damaging 0.77
R6431:Nr2c1 UTSW 10 94188216 missense probably damaging 1.00
R6844:Nr2c1 UTSW 10 94171167 nonsense probably null
R7707:Nr2c1 UTSW 10 94188165 missense probably benign 0.00
R7848:Nr2c1 UTSW 10 94190646 missense probably benign
R7931:Nr2c1 UTSW 10 94190646 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCACTATCAGAAGGTTAGCTC -3'
(R):5'- GGGTCTCATTTAACCAACGCTG -3'

Sequencing Primer
(F):5'- GCACTATCAGAAGGTTAGCTCTTAGC -3'
(R):5'- ACGCTGGCCTCAGATTAATG -3'
Posted On2018-08-01