Incidental Mutation 'R6745:Avil'
ID 530539
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Name advillin
Synonyms DOC6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R6745 (G1)
Quality Score 201.009
Status Validated
Chromosome 10
Chromosomal Location 127000709-127020994 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 127014119 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 613 (D613A)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]
AlphaFold O88398
Predicted Effect probably benign
Transcript: ENSMUST00000026500
AA Change: D613A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: D613A

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129173
AA Change: D613A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: D613A

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Meta Mutation Damage Score 0.0994 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 splice site probably null
R2026:Avil UTSW 10 127011873 missense probably damaging 1.00
R3694:Avil UTSW 10 127008330 missense probably damaging 0.98
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5285:Avil UTSW 10 127018459 missense probably damaging 0.97
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5682:Avil UTSW 10 127014104 missense probably damaging 1.00
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6804:Avil UTSW 10 127008306 nonsense probably null
R6838:Avil UTSW 10 127013562 missense probably benign
R7481:Avil UTSW 10 127007591 missense probably benign 0.33
R8213:Avil UTSW 10 127008321 missense probably damaging 0.97
R8349:Avil UTSW 10 127009992 missense probably benign 0.00
R8449:Avil UTSW 10 127009992 missense probably benign 0.00
R8510:Avil UTSW 10 127009781 missense probably benign 0.03
R8849:Avil UTSW 10 127008792 missense possibly damaging 0.91
R8944:Avil UTSW 10 127010586 missense probably damaging 1.00
R9101:Avil UTSW 10 127017004 missense probably benign 0.06
R9176:Avil UTSW 10 127016379 missense probably damaging 1.00
R9733:Avil UTSW 10 127007842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGATTCCCTCACAGCTTTAAAC -3'
(R):5'- TGGAGACCTTTGCCAGCATC -3'

Sequencing Primer
(F):5'- CTGGTGGCCTAGTCTAACCAAATG -3'
(R):5'- AGCATCCTGAACTTTGCGG -3'
Posted On 2018-08-01