Incidental Mutation 'R6745:Serpina1b'
ID 530543
Institutional Source Beutler Lab
Gene Symbol Serpina1b
Ensembl Gene ENSMUSG00000071178
Gene Name serine (or cysteine) preptidase inhibitor, clade A, member 1B
Synonyms PI2, D12Ucla2, Spi1-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R6745 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 103728156-103830373 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103730355 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 265 (N265S)
Ref Sequence ENSEMBL: ENSMUSP00000139941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095450] [ENSMUST00000164454] [ENSMUST00000186166] [ENSMUST00000187220]
AlphaFold P22599
Predicted Effect possibly damaging
Transcript: ENSMUST00000095450
AA Change: N265S

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093101
Gene: ENSMUSG00000071178
AA Change: N265S

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164454
AA Change: N265S

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178
AA Change: N265S

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186166
AA Change: N265S

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139941
Gene: ENSMUSG00000071178
AA Change: N265S

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187220
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Targeted disruption of this gene leads to significantly fewer than expected heterozygous and homozygous offspring from heterozygous matings. Homozygotes are healthy with no obvious changes in major organs while heterozygotes show a 30% decrease in serum anti-elastase and anti-chymotrypsin activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Serpina1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Serpina1b APN 12 103729296 missense possibly damaging 0.90
IGL00990:Serpina1b APN 12 103728266 missense probably damaging 1.00
IGL01947:Serpina1b APN 12 103729317 missense probably benign 0.00
IGL03258:Serpina1b APN 12 103730396 missense probably benign 0.00
IGL03392:Serpina1b APN 12 103732070 missense possibly damaging 0.53
R1937:Serpina1b UTSW 12 103732161 missense probably benign 0.00
R2383:Serpina1b UTSW 12 103728280 missense probably benign
R3789:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R4690:Serpina1b UTSW 12 103732380 missense probably damaging 1.00
R5164:Serpina1b UTSW 12 103732087 missense probably benign 0.01
R5650:Serpina1b UTSW 12 103728435 critical splice acceptor site probably null
R6017:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R6241:Serpina1b UTSW 12 103729256 splice site probably null
R6522:Serpina1b UTSW 12 103735037 splice site probably null
R6884:Serpina1b UTSW 12 103732453 missense probably benign 0.00
R7053:Serpina1b UTSW 12 103732429 missense possibly damaging 0.93
R7208:Serpina1b UTSW 12 103728294 missense probably benign 0.04
R7679:Serpina1b UTSW 12 103730515 missense probably damaging 1.00
R7908:Serpina1b UTSW 12 103728307 missense possibly damaging 0.65
R8056:Serpina1b UTSW 12 103817878 intron probably benign
R8237:Serpina1b UTSW 12 103818804 splice site probably null
R9092:Serpina1b UTSW 12 103730281 missense probably benign 0.00
R9112:Serpina1b UTSW 12 103732440 missense probably benign 0.08
R9123:Serpina1b UTSW 12 103730307 missense probably damaging 1.00
R9310:Serpina1b UTSW 12 103732497 missense probably benign 0.03
R9358:Serpina1b UTSW 12 103728394 missense possibly damaging 0.61
R9409:Serpina1b UTSW 12 103728348 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTATAGTCCACCCTCTGCAAG -3'
(R):5'- CAATGGGCTGTGTCATCACC -3'

Sequencing Primer
(F):5'- GCAAGCACTTTCTGTCCTTTGGG -3'
(R):5'- GTGTCATCACCTCATTGGCTAAGG -3'
Posted On 2018-08-01