Incidental Mutation 'R6745:Gpbp1'
ID530546
Institutional Source Beutler Lab
Gene Symbol Gpbp1
Ensembl Gene ENSMUSG00000032745
Gene NameGC-rich promoter binding protein 1
Synonyms1700034P14Rik, D230035M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location111425680-111490111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111453385 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 59 (R59C)
Ref Sequence ENSEMBL: ENSMUSP00000123249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047627] [ENSMUST00000091236] [ENSMUST00000136471] [ENSMUST00000231096]
Predicted Effect probably benign
Transcript: ENSMUST00000047627
AA Change: R59C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048240
Gene: ENSMUSG00000032745
AA Change: R59C

DomainStartEndE-ValueType
low complexity region 232 243 N/A INTRINSIC
Pfam:Vasculin 395 491 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091236
AA Change: R59C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088777
Gene: ENSMUSG00000032745
AA Change: R59C

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
Pfam:Vasculin 374 471 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129638
Predicted Effect probably benign
Transcript: ENSMUST00000136471
AA Change: R59C

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156221
Predicted Effect probably benign
Transcript: ENSMUST00000231096
AA Change: R59C

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Gpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gpbp1 APN 13 111440750 missense probably damaging 0.96
IGL01360:Gpbp1 APN 13 111426541 utr 3 prime probably benign
IGL01609:Gpbp1 APN 13 111439202 missense possibly damaging 0.62
IGL01747:Gpbp1 APN 13 111453050 missense probably damaging 0.99
IGL02614:Gpbp1 APN 13 111436473 missense probably benign 0.01
IGL03329:Gpbp1 APN 13 111453253 splice site probably benign
R0315:Gpbp1 UTSW 13 111436538 missense possibly damaging 0.50
R0510:Gpbp1 UTSW 13 111440745 missense possibly damaging 0.58
R1549:Gpbp1 UTSW 13 111436579 missense probably benign 0.00
R1582:Gpbp1 UTSW 13 111436532 splice site probably null
R1762:Gpbp1 UTSW 13 111440774 missense probably benign 0.02
R2074:Gpbp1 UTSW 13 111453407 missense probably benign 0.18
R2276:Gpbp1 UTSW 13 111466978 splice site probably null
R3685:Gpbp1 UTSW 13 111466871 missense probably benign 0.06
R4307:Gpbp1 UTSW 13 111448983 makesense probably null
R4408:Gpbp1 UTSW 13 111448964 missense possibly damaging 0.63
R4840:Gpbp1 UTSW 13 111440630 critical splice donor site probably null
R4952:Gpbp1 UTSW 13 111440750 missense probably damaging 0.96
R5152:Gpbp1 UTSW 13 111453281 intron probably benign
R5376:Gpbp1 UTSW 13 111426642 missense probably damaging 1.00
R6143:Gpbp1 UTSW 13 111466855 missense probably damaging 0.98
R6378:Gpbp1 UTSW 13 111433612 missense probably damaging 1.00
R6516:Gpbp1 UTSW 13 111453102 missense probably benign 0.05
R6687:Gpbp1 UTSW 13 111438085 missense possibly damaging 0.78
R7186:Gpbp1 UTSW 13 111440699 missense possibly damaging 0.89
R7310:Gpbp1 UTSW 13 111453390 missense probably benign 0.02
R7669:Gpbp1 UTSW 13 111439124 missense probably benign 0.16
R7881:Gpbp1 UTSW 13 111439199 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- ATTTCTGCCATGCGTACGC -3'
(R):5'- CTTGGAAGTAACTGCCTGTATTC -3'

Sequencing Primer
(F):5'- CCATGCGTACGCCATCC -3'
(R):5'- GGAAGTAACTGCCTGTATTCTTAATC -3'
Posted On2018-08-01