Incidental Mutation 'R6747:Nr5a2'
ID530561
Institutional Source Beutler Lab
Gene Symbol Nr5a2
Ensembl Gene ENSMUSG00000026398
Gene Namenuclear receptor subfamily 5, group A, member 2
SynonymsD1Ertd308e, Ftf, LRH-1, UF2-H3B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136842571-136960448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136882344 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 431 (E431G)
Ref Sequence ENSEMBL: ENSMUSP00000142219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027649] [ENSMUST00000168126] [ENSMUST00000192357] [ENSMUST00000192929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027649
AA Change: E452G

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027649
Gene: ENSMUSG00000026398
AA Change: E452G

DomainStartEndE-ValueType
ZnF_C4 104 175 2.85e-40 SMART
Blast:HOLI 196 247 1e-5 BLAST
low complexity region 290 302 N/A INTRINSIC
HOLI 366 529 4.13e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168126
AA Change: E391G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129071
Gene: ENSMUSG00000026398
AA Change: E391G

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192357
AA Change: E431G

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142219
Gene: ENSMUSG00000026398
AA Change: E431G

DomainStartEndE-ValueType
ZnF_C4 83 154 1.1e-42 SMART
Blast:HOLI 175 226 1e-5 BLAST
low complexity region 269 281 N/A INTRINSIC
HOLI 345 508 1.7e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192929
AA Change: E391G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141495
Gene: ENSMUSG00000026398
AA Change: E391G

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Meta Mutation Damage Score 0.5713 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die around embryonic day 7.5. Heterozygotes are essentially normal but with lower plasma cholesterol, increased bile acids, and shorter intestinal crypt length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Nr5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Nr5a2 APN 1 136890798 missense probably damaging 1.00
IGL01082:Nr5a2 APN 1 136845468 missense probably benign 0.06
IGL02547:Nr5a2 APN 1 136940927 missense probably benign 0.01
IGL02688:Nr5a2 APN 1 136940407 critical splice donor site probably null
IGL02712:Nr5a2 APN 1 136940528 unclassified probably null
aggressivity UTSW 1 136882344 missense possibly damaging 0.78
R0356:Nr5a2 UTSW 1 136845692 missense possibly damaging 0.91
R0653:Nr5a2 UTSW 1 136948805 missense probably benign 0.04
R1111:Nr5a2 UTSW 1 136882421 splice site probably null
R1728:Nr5a2 UTSW 1 136952125 missense probably benign
R1729:Nr5a2 UTSW 1 136952125 missense probably benign
R1730:Nr5a2 UTSW 1 136952125 missense probably benign
R1739:Nr5a2 UTSW 1 136952125 missense probably benign
R1762:Nr5a2 UTSW 1 136952125 missense probably benign
R1783:Nr5a2 UTSW 1 136952125 missense probably benign
R1784:Nr5a2 UTSW 1 136952125 missense probably benign
R1785:Nr5a2 UTSW 1 136952125 missense probably benign
R1927:Nr5a2 UTSW 1 136944994 missense probably damaging 1.00
R2360:Nr5a2 UTSW 1 136948827 missense probably benign
R3408:Nr5a2 UTSW 1 136940498 missense probably benign
R4662:Nr5a2 UTSW 1 136940429 missense probably benign 0.00
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R5176:Nr5a2 UTSW 1 136948802 start codon destroyed probably null 0.96
R5999:Nr5a2 UTSW 1 136845542 missense probably damaging 1.00
R6191:Nr5a2 UTSW 1 136890798 missense probably damaging 1.00
R6457:Nr5a2 UTSW 1 136960238 missense probably benign 0.00
X0012:Nr5a2 UTSW 1 136943292 missense probably damaging 1.00
X0065:Nr5a2 UTSW 1 136940777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGCTTACCTGACCACCAG -3'
(R):5'- AACTGGCTCTGTCAGACTGG -3'

Sequencing Primer
(F):5'- TGCCATTGAAAGCAAATTCACATC -3'
(R):5'- GGCCTCTGTGTTGGAAATCTACAC -3'
Posted On2018-08-01