Incidental Mutation 'R6747:Arhgap30'
ID530562
Institutional Source Beutler Lab
Gene Symbol Arhgap30
Ensembl Gene ENSMUSG00000048865
Gene NameRho GTPase activating protein 30
Synonyms6030405P05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location171388954-171410298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171407729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000059389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000056449] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546]
Predicted Effect probably benign
Transcript: ENSMUST00000001284
Predicted Effect probably damaging
Transcript: ENSMUST00000056449
AA Change: V557A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865
AA Change: V557A

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Predicted Effect probably benign
Transcript: ENSMUST00000159207
SMART Domains Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160335
Predicted Effect probably benign
Transcript: ENSMUST00000160486
SMART Domains Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161241
SMART Domains Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161297
Predicted Effect probably benign
Transcript: ENSMUST00000167546
SMART Domains Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Arhgap30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Arhgap30 APN 1 171397570 missense probably damaging 1.00
IGL02016:Arhgap30 APN 1 171407747 missense probably damaging 1.00
IGL02552:Arhgap30 APN 1 171407756 missense probably damaging 1.00
IGL03343:Arhgap30 APN 1 171409094 missense probably damaging 1.00
consonance UTSW 1 171404139 critical splice donor site probably null
deliverance UTSW 1 171397518 nonsense probably null
redemption UTSW 1 171402254 missense probably damaging 1.00
tercero UTSW 1 171408341 missense probably benign
FR4304:Arhgap30 UTSW 1 171405168 small insertion probably benign
P0017:Arhgap30 UTSW 1 171408704 missense probably benign 0.02
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0115:Arhgap30 UTSW 1 171407948 missense possibly damaging 0.92
R0320:Arhgap30 UTSW 1 171403804 missense possibly damaging 0.81
R0399:Arhgap30 UTSW 1 171404816 missense probably damaging 0.97
R0945:Arhgap30 UTSW 1 171403286 missense probably damaging 1.00
R1484:Arhgap30 UTSW 1 171403271 missense probably damaging 1.00
R1595:Arhgap30 UTSW 1 171408341 missense probably benign
R2173:Arhgap30 UTSW 1 171407767 missense probably damaging 1.00
R2281:Arhgap30 UTSW 1 171389328 missense probably damaging 1.00
R2864:Arhgap30 UTSW 1 171408206 missense probably damaging 1.00
R4066:Arhgap30 UTSW 1 171408323 missense probably benign
R4888:Arhgap30 UTSW 1 171409312 missense probably benign
R4937:Arhgap30 UTSW 1 171403329 missense probably benign 0.03
R4944:Arhgap30 UTSW 1 171402254 missense probably damaging 1.00
R5170:Arhgap30 UTSW 1 171408050 missense probably benign 0.00
R5218:Arhgap30 UTSW 1 171408760 missense probably benign
R5385:Arhgap30 UTSW 1 171408280 missense probably benign
R5541:Arhgap30 UTSW 1 171404139 critical splice donor site probably null
R6028:Arhgap30 UTSW 1 171408320 missense probably benign
R6748:Arhgap30 UTSW 1 171404810 missense possibly damaging 0.50
R6869:Arhgap30 UTSW 1 171409055 missense probably damaging 1.00
R7223:Arhgap30 UTSW 1 171407571 missense probably damaging 1.00
R8113:Arhgap30 UTSW 1 171397518 nonsense probably null
R8543:Arhgap30 UTSW 1 171404962 missense probably damaging 1.00
R8545:Arhgap30 UTSW 1 171407430 missense probably damaging 1.00
R8682:Arhgap30 UTSW 1 171407402 missense probably benign 0.00
R8693:Arhgap30 UTSW 1 171397526 missense probably damaging 1.00
X0020:Arhgap30 UTSW 1 171405085 missense possibly damaging 0.53
Z1177:Arhgap30 UTSW 1 171407908 missense probably benign 0.01
Z1189:Arhgap30 UTSW 1 171408370 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAGGATTTGAGCAGCTCAG -3'
(R):5'- AGGGGACTCAGATCATCATAGG -3'

Sequencing Primer
(F):5'- ATTTGAGCAGCTCAGAGCCTG -3'
(R):5'- GGGACTCAGATCATCATAGGCACTC -3'
Posted On2018-08-01