Incidental Mutation 'R6747:Nelfb'
ID530564
Institutional Source Beutler Lab
Gene Symbol Nelfb
Ensembl Gene ENSMUSG00000013465
Gene Namenegative elongation factor complex member B
SynonymsA730008L03Rik, Cobra1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25199712-25211489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25203381 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 453 (T453I)
Ref Sequence ENSEMBL: ENSMUSP00000057731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059849]
Predicted Effect probably benign
Transcript: ENSMUST00000059849
AA Change: T453I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465
AA Change: T453I

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124900
AA Change: T22I
SMART Domains Protein: ENSMUSP00000115296
Gene: ENSMUSG00000013465
AA Change: T22I

DomainStartEndE-ValueType
Pfam:COBRA1 1 144 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138199
Predicted Effect probably benign
Transcript: ENSMUST00000140934
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147890
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes subunit B of a metazoan-specific, four-subunit protein complex that regulates promoter-proximal pausing of RNA polymerase II. RNA polymerase II pausing is thought to be important for coordination of gene transcription during embryonic development and stress responses. Consistently, disruption of this gene in mouse causes inner cell mass deficiency and embryonic lethality. In addition, this gene is required for maintenance of mouse embryonic stem cells by preventing expression of developmental genes. In adult mice, conditional deletion of this gene results in cardiomyopathy and impaired response to cardiac stress. Multiple protein isoforms are encoded through the use of a non-AUG (CUG) initiation codon and an alternative downstream AUG initiation codon. In addition, alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele fail to develop inner cell masses and die between E5 and E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Nelfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Nelfb APN 2 25204288 missense possibly damaging 0.94
IGL01573:Nelfb APN 2 25203957 missense probably damaging 1.00
IGL03109:Nelfb APN 2 25201061 missense possibly damaging 0.95
IGL03255:Nelfb APN 2 25203195 missense probably benign 0.21
R0541:Nelfb UTSW 2 25203980 missense probably benign 0.01
R2046:Nelfb UTSW 2 25206311 missense probably damaging 0.97
R4832:Nelfb UTSW 2 25209969 missense probably damaging 1.00
R4995:Nelfb UTSW 2 25206196 missense probably benign 0.01
R5299:Nelfb UTSW 2 25210745 missense probably benign 0.20
R5663:Nelfb UTSW 2 25203489 missense probably benign 0.01
R5854:Nelfb UTSW 2 25209993 missense probably damaging 1.00
R5987:Nelfb UTSW 2 25203888 missense probably damaging 1.00
R7025:Nelfb UTSW 2 25210493 missense probably damaging 1.00
R8118:Nelfb UTSW 2 25205159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAGTACTCACCAAGTCCAGG -3'
(R):5'- GTCTATTGAGAGCAGCCAGG -3'

Sequencing Primer
(F):5'- GCGCAGGAGAGCATTCTTG -3'
(R):5'- AGCAGCCAGGCTCAGGG -3'
Posted On2018-08-01