Incidental Mutation 'R6747:Arhgap15'
ID 530565
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene Name Rho GTPase activating protein 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock # R6747 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 43748824-44395953 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 44116677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 269 (P269T)
Ref Sequence ENSEMBL: ENSMUSP00000108443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
AlphaFold Q811M1
Predicted Effect probably damaging
Transcript: ENSMUST00000055776
AA Change: P269T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: P269T

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112824
AA Change: P269T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: P269T

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128630
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44243153 missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 44065045 missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43780755 missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 44063808 missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 44063837 missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44116662 missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44142350 critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43780736 missense probably damaging 1.00
PIT4468001:Arhgap15 UTSW 2 44243131 missense probably damaging 1.00
R0140:Arhgap15 UTSW 2 44322767 missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 44063766 missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44116617 missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44116717 critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44142295 missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44243124 missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44386347 missense probably damaging 1.00
R2905:Arhgap15 UTSW 2 44063786 missense probably damaging 0.97
R4788:Arhgap15 UTSW 2 43748890 start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44142341 missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43844813 critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44322755 missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R5202:Arhgap15 UTSW 2 44063857 missense probably benign 0.22
R5446:Arhgap15 UTSW 2 43828760 missense probably benign 0.00
R5661:Arhgap15 UTSW 2 44322727 missense possibly damaging 0.54
R7392:Arhgap15 UTSW 2 44063774 missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43780636 missense probably benign 0.01
R7658:Arhgap15 UTSW 2 44142268 missense probably benign 0.18
R7735:Arhgap15 UTSW 2 44116630 missense probably damaging 1.00
R8734:Arhgap15 UTSW 2 44243118 missense probably damaging 1.00
R8743:Arhgap15 UTSW 2 43748864 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCTACCTTAGACAGCAG -3'
(R):5'- CTCTGAGGCTAACTCTGGATATTTC -3'

Sequencing Primer
(F):5'- AGAGCCCTGCTAGTCATCC -3'
(R):5'- GAGGCTAACTCTGGATATTTCTTTTC -3'
Posted On 2018-08-01