Incidental Mutation 'R6747:Stard9'
ID 530568
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name START domain containing 9
Synonyms E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R6747 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120629121-120731895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 120698383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 1707 (H1707P)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000180041
AA Change: H1707P

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: H1707P

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 (GRCm38) probably null Het
Acyp1 C T 12: 85,278,905 (GRCm38) V107I probably null Het
Aftph T C 11: 20,726,144 (GRCm38) probably null Het
Agtpbp1 A T 13: 59,544,353 (GRCm38) probably null Het
Arhgap15 C A 2: 44,116,677 (GRCm38) P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 (GRCm38) V557A probably damaging Het
Asb3 T A 11: 31,081,493 (GRCm38) M410K probably benign Het
B4galnt2 T C 11: 95,868,634 (GRCm38) probably null Het
Birc3 A G 9: 7,860,261 (GRCm38) probably null Het
Cav2 A T 6: 17,286,951 (GRCm38) N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 (GRCm38) C826Y probably benign Het
Cenpf T A 1: 189,652,854 (GRCm38) T2410S probably benign Het
Chchd1 A G 14: 20,703,380 (GRCm38) D24G probably benign Het
Cmip G A 8: 117,436,879 (GRCm38) G450S probably benign Het
Col11a1 C T 3: 114,212,450 (GRCm38) Q534* probably null Het
Col3a1 G T 1: 45,338,622 (GRCm38) probably benign Het
Cox4i1 T C 8: 120,673,230 (GRCm38) I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 (GRCm38) V168F probably damaging Het
Dapk1 T C 13: 60,725,340 (GRCm38) I352T probably benign Het
Ddx52 T C 11: 83,955,302 (GRCm38) V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 (GRCm38) H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 (GRCm38) T369A probably benign Het
Dppa1 T A 11: 46,625,595 (GRCm38) I8F unknown Het
Ebf1 G T 11: 44,883,814 (GRCm38) V213F probably damaging Het
Foxb2 C A 19: 16,872,833 (GRCm38) E270* probably null Het
Gclc A T 9: 77,788,245 (GRCm38) R450W probably damaging Het
Gm13128 T C 4: 144,332,978 (GRCm38) W420R probably benign Het
Grin2d T C 7: 45,862,268 (GRCm38) E251G probably damaging Het
Hal A T 10: 93,500,677 (GRCm38) N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 (GRCm38) I185F unknown Het
Lrp3 T A 7: 35,211,437 (GRCm38) Q61L probably benign Het
Met A C 6: 17,571,467 (GRCm38) Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 (GRCm38) N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 (GRCm38) W16C probably benign Het
Myh13 G A 11: 67,350,419 (GRCm38) R874Q probably damaging Het
Nelfb G A 2: 25,203,381 (GRCm38) T453I probably benign Het
Nos2 A G 11: 78,952,954 (GRCm38) D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 (GRCm38) E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 (GRCm38) D149G probably benign Het
Olfr203 T C 16: 59,303,641 (GRCm38) F164L probably benign Het
Olfr690 C T 7: 105,330,027 (GRCm38) R55H probably benign Het
Pcbp4 C A 9: 106,460,648 (GRCm38) probably null Het
Peg10 A G 6: 4,757,137 (GRCm38) probably benign Het
Pms2 C T 5: 143,925,419 (GRCm38) P154L probably benign Het
Pou6f2 A C 13: 18,129,187 (GRCm38) L112R probably benign Het
Prdm6 A T 18: 53,465,046 (GRCm38) probably benign Het
Prob1 G A 18: 35,655,154 (GRCm38) R12W probably damaging Het
Rif1 T A 2: 52,078,263 (GRCm38) probably null Het
Rpl9-ps6 A G 19: 32,466,143 (GRCm38) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 (GRCm38) probably benign Homo
Sec23ip A G 7: 128,752,849 (GRCm38) silent Het
Slc38a9 T C 13: 112,690,180 (GRCm38) C151R probably benign Het
Slc39a8 T C 3: 135,849,180 (GRCm38) probably null Het
Slc6a18 C A 13: 73,677,991 (GRCm38) probably benign Het
Snw1 T C 12: 87,464,710 (GRCm38) D57G probably damaging Het
Sox6 C G 7: 115,541,731 (GRCm38) R505P probably damaging Het
Speg T C 1: 75,410,395 (GRCm38) probably null Het
Spire2 C T 8: 123,356,846 (GRCm38) R190C probably damaging Het
Tenm3 G T 8: 48,343,243 (GRCm38) T237K probably damaging Het
Themis2 T A 4: 132,796,262 (GRCm38) E31V possibly damaging Het
Trim56 T G 5: 137,114,521 (GRCm38) Q47P probably damaging Het
Trim58 T C 11: 58,651,264 (GRCm38) I350T probably benign Het
Ttll7 C T 3: 146,944,056 (GRCm38) P639S probably benign Het
Ubxn6 A G 17: 56,070,650 (GRCm38) probably null Het
Vmn2r114 A T 17: 23,309,876 (GRCm38) F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 (GRCm38) M822L probably benign Het
Vps9d1 T C 8: 123,254,007 (GRCm38) D27G probably damaging Het
Wdr3 C T 3: 100,138,724 (GRCm38) R931Q probably damaging Het
Whamm G A 7: 81,578,302 (GRCm38) probably null Het
Zcchc24 T C 14: 25,757,033 (GRCm38) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm38) K2050R probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120,701,847 (GRCm38) missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120,698,479 (GRCm38) missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120,698,719 (GRCm38) missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120,701,368 (GRCm38) missense probably benign 0.04
IGL01394:Stard9 APN 2 120,706,327 (GRCm38) missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120,673,604 (GRCm38) missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120,703,330 (GRCm38) missense probably damaging 1.00
IGL01810:Stard9 APN 2 120,699,084 (GRCm38) missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120,706,446 (GRCm38) missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120,668,016 (GRCm38) missense probably damaging 1.00
IGL02031:Stard9 APN 2 120,702,339 (GRCm38) missense probably benign 0.27
IGL02081:Stard9 APN 2 120,664,910 (GRCm38) missense probably damaging 0.98
IGL02558:Stard9 APN 2 120,696,907 (GRCm38) missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120,698,992 (GRCm38) missense probably damaging 1.00
IGL02873:Stard9 APN 2 120,713,807 (GRCm38) missense probably damaging 1.00
IGL03195:Stard9 APN 2 120,705,802 (GRCm38) missense probably damaging 1.00
IGL03204:Stard9 APN 2 120,705,802 (GRCm38) missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120,696,085 (GRCm38) small insertion probably benign
IGL03014:Stard9 UTSW 2 120,702,194 (GRCm38) unclassified probably benign
PIT4151001:Stard9 UTSW 2 120,702,756 (GRCm38) nonsense probably null
PIT4498001:Stard9 UTSW 2 120,697,435 (GRCm38) missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120,703,501 (GRCm38) missense probably benign
R0027:Stard9 UTSW 2 120,703,501 (GRCm38) missense probably benign
R0038:Stard9 UTSW 2 120,695,832 (GRCm38) missense probably benign
R0049:Stard9 UTSW 2 120,699,819 (GRCm38) missense probably damaging 1.00
R0049:Stard9 UTSW 2 120,699,819 (GRCm38) missense probably damaging 1.00
R0116:Stard9 UTSW 2 120,634,255 (GRCm38) missense probably damaging 0.99
R0398:Stard9 UTSW 2 120,696,307 (GRCm38) missense probably benign 0.03
R0479:Stard9 UTSW 2 120,697,596 (GRCm38) missense probably damaging 1.00
R0556:Stard9 UTSW 2 120,698,923 (GRCm38) missense probably benign 0.09
R0589:Stard9 UTSW 2 120,698,547 (GRCm38) missense probably benign 0.00
R0609:Stard9 UTSW 2 120,706,306 (GRCm38) missense probably damaging 1.00
R0611:Stard9 UTSW 2 120,699,257 (GRCm38) missense probably benign 0.00
R0683:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R0751:Stard9 UTSW 2 120,697,485 (GRCm38) missense probably benign 0.04
R0833:Stard9 UTSW 2 120,696,999 (GRCm38) missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120,696,999 (GRCm38) missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120,700,842 (GRCm38) missense probably damaging 1.00
R0848:Stard9 UTSW 2 120,695,823 (GRCm38) missense probably damaging 1.00
R0849:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R0961:Stard9 UTSW 2 120,693,439 (GRCm38) missense probably benign 0.01
R0993:Stard9 UTSW 2 120,705,169 (GRCm38) missense probably damaging 1.00
R1005:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1006:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1115:Stard9 UTSW 2 120,692,850 (GRCm38) missense probably benign 0.05
R1163:Stard9 UTSW 2 120,696,213 (GRCm38) missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1200:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1331:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1332:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1333:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1334:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1335:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1336:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1338:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1346:Stard9 UTSW 2 120,713,448 (GRCm38) missense probably damaging 1.00
R1370:Stard9 UTSW 2 120,697,477 (GRCm38) missense probably benign 0.11
R1384:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1401:Stard9 UTSW 2 120,712,847 (GRCm38) splice site probably benign
R1416:Stard9 UTSW 2 120,700,972 (GRCm38) missense probably benign 0.00
R1453:Stard9 UTSW 2 120,666,376 (GRCm38) missense probably damaging 1.00
R1468:Stard9 UTSW 2 120,703,197 (GRCm38) missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120,703,197 (GRCm38) missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120,702,052 (GRCm38) missense probably benign 0.09
R1538:Stard9 UTSW 2 120,696,711 (GRCm38) missense probably benign 0.25
R1614:Stard9 UTSW 2 120,697,675 (GRCm38) missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120,703,722 (GRCm38) missense probably benign 0.37
R1658:Stard9 UTSW 2 120,701,542 (GRCm38) missense probably benign 0.02
R1686:Stard9 UTSW 2 120,699,492 (GRCm38) missense probably benign 0.00
R1797:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1803:Stard9 UTSW 2 120,701,489 (GRCm38) missense probably benign 0.24
R1806:Stard9 UTSW 2 120,679,453 (GRCm38) splice site probably null
R1847:Stard9 UTSW 2 120,698,489 (GRCm38) missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120,688,751 (GRCm38) missense probably damaging 1.00
R1892:Stard9 UTSW 2 120,693,708 (GRCm38) missense probably benign 0.01
R1906:Stard9 UTSW 2 120,696,427 (GRCm38) missense probably benign 0.00
R1907:Stard9 UTSW 2 120,713,812 (GRCm38) missense probably damaging 1.00
R1930:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R1933:Stard9 UTSW 2 120,698,656 (GRCm38) missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120,701,406 (GRCm38) missense probably benign
R1999:Stard9 UTSW 2 120,692,868 (GRCm38) missense probably damaging 0.99
R2004:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,673,636 (GRCm38) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,664,945 (GRCm38) missense possibly damaging 0.90
R2021:Stard9 UTSW 2 120,704,235 (GRCm38) missense probably benign 0.05
R2025:Stard9 UTSW 2 120,702,398 (GRCm38) missense probably benign 0.20
R2190:Stard9 UTSW 2 120,714,120 (GRCm38) missense probably benign 0.22
R2204:Stard9 UTSW 2 120,698,531 (GRCm38) frame shift probably null
R2422:Stard9 UTSW 2 120,700,284 (GRCm38) missense probably benign 0.29
R3401:Stard9 UTSW 2 120,703,689 (GRCm38) missense probably damaging 0.98
R3618:Stard9 UTSW 2 120,699,019 (GRCm38) missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120,699,019 (GRCm38) missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120,713,549 (GRCm38) missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120,698,229 (GRCm38) missense probably benign 0.11
R4022:Stard9 UTSW 2 120,704,155 (GRCm38) missense probably benign 0.05
R4223:Stard9 UTSW 2 120,664,991 (GRCm38) missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120,664,991 (GRCm38) missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120,664,991 (GRCm38) missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120,701,946 (GRCm38) missense probably benign 0.43
R4382:Stard9 UTSW 2 120,634,222 (GRCm38) missense probably damaging 1.00
R4453:Stard9 UTSW 2 120,697,791 (GRCm38) missense probably benign
R4499:Stard9 UTSW 2 120,700,241 (GRCm38) missense probably benign 0.05
R4524:Stard9 UTSW 2 120,696,445 (GRCm38) missense probably damaging 1.00
R4671:Stard9 UTSW 2 120,698,640 (GRCm38) missense probably damaging 0.98
R4701:Stard9 UTSW 2 120,705,713 (GRCm38) missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120,696,123 (GRCm38) missense probably benign 0.01
R4822:Stard9 UTSW 2 120,695,941 (GRCm38) missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120,703,113 (GRCm38) missense probably benign 0.18
R4863:Stard9 UTSW 2 120,700,860 (GRCm38) missense probably benign 0.00
R4898:Stard9 UTSW 2 120,706,419 (GRCm38) nonsense probably null
R5033:Stard9 UTSW 2 120,693,399 (GRCm38) missense probably benign 0.00
R5087:Stard9 UTSW 2 120,697,019 (GRCm38) nonsense probably null
R5157:Stard9 UTSW 2 120,697,861 (GRCm38) missense probably benign
R5213:Stard9 UTSW 2 120,699,226 (GRCm38) missense probably damaging 1.00
R5237:Stard9 UTSW 2 120,699,358 (GRCm38) missense probably damaging 0.96
R5257:Stard9 UTSW 2 120,699,343 (GRCm38) missense probably damaging 0.99
R5258:Stard9 UTSW 2 120,699,343 (GRCm38) missense probably damaging 0.99
R5273:Stard9 UTSW 2 120,705,087 (GRCm38) missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120,701,947 (GRCm38) missense probably benign 0.43
R5288:Stard9 UTSW 2 120,700,630 (GRCm38) missense probably damaging 0.98
R5292:Stard9 UTSW 2 120,699,145 (GRCm38) missense probably benign 0.17
R5328:Stard9 UTSW 2 120,699,230 (GRCm38) missense probably damaging 1.00
R5385:Stard9 UTSW 2 120,700,630 (GRCm38) missense probably damaging 0.98
R5386:Stard9 UTSW 2 120,700,630 (GRCm38) missense probably damaging 0.98
R5393:Stard9 UTSW 2 120,702,906 (GRCm38) missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120,693,668 (GRCm38) missense probably benign 0.17
R5685:Stard9 UTSW 2 120,705,322 (GRCm38) missense probably damaging 1.00
R5749:Stard9 UTSW 2 120,703,786 (GRCm38) missense probably damaging 1.00
R5780:Stard9 UTSW 2 120,703,396 (GRCm38) missense probably benign 0.02
R5901:Stard9 UTSW 2 120,701,370 (GRCm38) missense probably damaging 1.00
R5941:Stard9 UTSW 2 120,713,558 (GRCm38) missense probably damaging 1.00
R5960:Stard9 UTSW 2 120,699,961 (GRCm38) missense probably benign 0.05
R5966:Stard9 UTSW 2 120,697,099 (GRCm38) missense probably damaging 1.00
R5967:Stard9 UTSW 2 120,706,894 (GRCm38) missense probably damaging 0.99
R6012:Stard9 UTSW 2 120,704,586 (GRCm38) missense probably damaging 1.00
R6019:Stard9 UTSW 2 120,693,715 (GRCm38) frame shift probably null
R6020:Stard9 UTSW 2 120,693,715 (GRCm38) frame shift probably null
R6036:Stard9 UTSW 2 120,700,075 (GRCm38) missense probably benign 0.09
R6036:Stard9 UTSW 2 120,700,075 (GRCm38) missense probably benign 0.09
R6090:Stard9 UTSW 2 120,693,654 (GRCm38) missense probably damaging 0.99
R6192:Stard9 UTSW 2 120,696,760 (GRCm38) missense probably damaging 0.99
R6228:Stard9 UTSW 2 120,713,750 (GRCm38) missense probably damaging 1.00
R6235:Stard9 UTSW 2 120,713,546 (GRCm38) missense probably damaging 1.00
R6280:Stard9 UTSW 2 120,701,127 (GRCm38) missense probably benign
R6338:Stard9 UTSW 2 120,697,485 (GRCm38) missense probably benign
R6344:Stard9 UTSW 2 120,704,320 (GRCm38) missense probably benign 0.12
R6364:Stard9 UTSW 2 120,713,429 (GRCm38) missense probably damaging 1.00
R6383:Stard9 UTSW 2 120,666,407 (GRCm38) critical splice donor site probably null
R6644:Stard9 UTSW 2 120,695,772 (GRCm38) missense probably benign 0.11
R6833:Stard9 UTSW 2 120,701,259 (GRCm38) missense probably damaging 1.00
R6836:Stard9 UTSW 2 120,699,843 (GRCm38) missense probably benign 0.15
R6861:Stard9 UTSW 2 120,705,186 (GRCm38) missense probably benign 0.09
R6872:Stard9 UTSW 2 120,714,068 (GRCm38) nonsense probably null
R6875:Stard9 UTSW 2 120,697,436 (GRCm38) missense probably benign 0.04
R6915:Stard9 UTSW 2 120,702,630 (GRCm38) missense probably benign 0.00
R6934:Stard9 UTSW 2 120,697,695 (GRCm38) missense probably benign 0.00
R6943:Stard9 UTSW 2 120,702,196 (GRCm38) missense probably benign 0.29
R7009:Stard9 UTSW 2 120,697,191 (GRCm38) missense probably benign 0.37
R7031:Stard9 UTSW 2 120,700,450 (GRCm38) missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120,679,378 (GRCm38) nonsense probably null
R7151:Stard9 UTSW 2 120,696,142 (GRCm38) missense probably benign
R7154:Stard9 UTSW 2 120,704,542 (GRCm38) missense probably benign 0.02
R7154:Stard9 UTSW 2 120,701,314 (GRCm38) missense probably benign 0.00
R7165:Stard9 UTSW 2 120,704,158 (GRCm38) missense probably damaging 1.00
R7260:Stard9 UTSW 2 120,706,938 (GRCm38) missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120,634,274 (GRCm38) nonsense probably null
R7282:Stard9 UTSW 2 120,698,503 (GRCm38) missense probably benign 0.00
R7344:Stard9 UTSW 2 120,704,686 (GRCm38) missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120,666,534 (GRCm38) missense probably benign
R7359:Stard9 UTSW 2 120,698,280 (GRCm38) missense probably damaging 1.00
R7375:Stard9 UTSW 2 120,665,002 (GRCm38) splice site probably null
R7410:Stard9 UTSW 2 120,701,497 (GRCm38) missense probably benign 0.41
R7422:Stard9 UTSW 2 120,702,152 (GRCm38) missense probably benign 0.21
R7475:Stard9 UTSW 2 120,688,110 (GRCm38) missense probably damaging 1.00
R7523:Stard9 UTSW 2 120,699,597 (GRCm38) missense probably benign
R7553:Stard9 UTSW 2 120,693,808 (GRCm38) splice site probably null
R7624:Stard9 UTSW 2 120,688,146 (GRCm38) missense probably benign 0.15
R7761:Stard9 UTSW 2 120,699,379 (GRCm38) missense probably benign 0.00
R7794:Stard9 UTSW 2 120,704,430 (GRCm38) missense probably benign 0.01
R7819:Stard9 UTSW 2 120,700,984 (GRCm38) missense probably damaging 1.00
R7823:Stard9 UTSW 2 120,702,106 (GRCm38) missense probably damaging 0.96
R7837:Stard9 UTSW 2 120,703,665 (GRCm38) missense probably benign 0.06
R7889:Stard9 UTSW 2 120,704,461 (GRCm38) missense probably benign 0.11
R7905:Stard9 UTSW 2 120,696,081 (GRCm38) missense not run
R7956:Stard9 UTSW 2 120,705,371 (GRCm38) nonsense probably null
R8013:Stard9 UTSW 2 120,688,101 (GRCm38) missense probably damaging 1.00
R8113:Stard9 UTSW 2 120,704,430 (GRCm38) missense probably benign 0.01
R8114:Stard9 UTSW 2 120,704,430 (GRCm38) missense probably benign 0.01
R8116:Stard9 UTSW 2 120,664,939 (GRCm38) nonsense probably null
R8117:Stard9 UTSW 2 120,704,430 (GRCm38) missense probably benign 0.01
R8118:Stard9 UTSW 2 120,704,430 (GRCm38) missense probably benign 0.01
R8170:Stard9 UTSW 2 120,700,048 (GRCm38) missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120,704,769 (GRCm38) missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120,701,789 (GRCm38) missense probably benign 0.00
R8337:Stard9 UTSW 2 120,679,825 (GRCm38) missense probably damaging 1.00
R8536:Stard9 UTSW 2 120,714,659 (GRCm38) missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120,703,315 (GRCm38) missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120,701,114 (GRCm38) missense probably benign 0.02
R8708:Stard9 UTSW 2 120,703,578 (GRCm38) missense probably damaging 1.00
R8732:Stard9 UTSW 2 120,679,961 (GRCm38) missense probably damaging 1.00
R8798:Stard9 UTSW 2 120,704,731 (GRCm38) missense probably benign 0.09
R8807:Stard9 UTSW 2 120,705,451 (GRCm38) missense probably damaging 1.00
R8807:Stard9 UTSW 2 120,705,462 (GRCm38) missense probably damaging 1.00
R8862:Stard9 UTSW 2 120,703,618 (GRCm38) missense probably benign
R8920:Stard9 UTSW 2 120,702,607 (GRCm38) missense probably damaging 0.96
R9026:Stard9 UTSW 2 120,705,802 (GRCm38) missense probably damaging 1.00
R9048:Stard9 UTSW 2 120,677,934 (GRCm38) missense probably damaging 0.99
R9049:Stard9 UTSW 2 120,679,937 (GRCm38) missense probably benign 0.30
R9152:Stard9 UTSW 2 120,698,587 (GRCm38) missense probably damaging 0.99
R9189:Stard9 UTSW 2 120,703,019 (GRCm38) missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120,697,966 (GRCm38) missense probably damaging 1.00
R9372:Stard9 UTSW 2 120,664,939 (GRCm38) nonsense probably null
R9393:Stard9 UTSW 2 120,688,175 (GRCm38) missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120,664,933 (GRCm38) missense probably damaging 1.00
R9514:Stard9 UTSW 2 120,704,083 (GRCm38) missense probably damaging 1.00
R9515:Stard9 UTSW 2 120,704,083 (GRCm38) missense probably damaging 1.00
R9516:Stard9 UTSW 2 120,704,083 (GRCm38) missense probably damaging 1.00
R9570:Stard9 UTSW 2 120,704,233 (GRCm38) missense probably benign 0.02
R9649:Stard9 UTSW 2 120,696,154 (GRCm38) missense probably benign 0.20
R9789:Stard9 UTSW 2 120,679,936 (GRCm38) missense probably damaging 1.00
X0023:Stard9 UTSW 2 120,702,963 (GRCm38) missense possibly damaging 0.92
X0023:Stard9 UTSW 2 120,702,744 (GRCm38) missense probably benign 0.00
Z1176:Stard9 UTSW 2 120,698,322 (GRCm38) missense probably damaging 1.00
Z1176:Stard9 UTSW 2 120,696,612 (GRCm38) missense probably benign
Z1176:Stard9 UTSW 2 120,695,818 (GRCm38) missense probably benign 0.01
Z1177:Stard9 UTSW 2 120,673,676 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCTGAGTTGTTCCTGCAC -3'
(R):5'- TGCTGTCTGTTCTGAGCAAC -3'

Sequencing Primer
(F):5'- TGCACTCTACCCCCTGGAG -3'
(R):5'- GCTGTCTGTTCTGAGCAACAAAAG -3'
Posted On 2018-08-01