Incidental Mutation 'R6747:Abca4'
ID530570
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6747 (G1)
Quality Score216.009
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationintron (53 bp from exon)
DNA Base Change (assembly) C to T at 122126313 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably null
Transcript: ENSMUST00000013995
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198484
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7944:Abca4 UTSW 3 122069248 intron probably null
Z1176:Abca4 UTSW 3 122103488
Z1176:Abca4 UTSW 3 122156443
Z1177:Abca4 UTSW 3 122147786
Z1177:Abca4 UTSW 3 122173914
Predicted Primers PCR Primer
(F):5'- TGTTCTATGCCCAGCTGAAAGG -3'
(R):5'- TCCCGTTATAAGGCCCTACC -3'

Sequencing Primer
(F):5'- CCAGCTGAAAGGGAGATCC -3'
(R):5'- GTTATAAGGCCCTACCCCAGTG -3'
Posted On2018-08-01