Incidental Mutation 'R6747:Ttll7'
ID 530572
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Name tubulin tyrosine ligase-like family, member 7
Synonyms 1110049N09Rik, 4921517B04Rik
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.519) question?
Stock # R6747 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 146558122-146689764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 146649811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 639 (P639S)
Ref Sequence ENSEMBL: ENSMUSP00000043753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037942
AA Change: P639S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106134
AA Change: P614S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: P614S

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170055
AA Change: P614S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: P614S

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197547
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 121,919,962 (GRCm39) probably null Het
Acyp1 C T 12: 85,325,679 (GRCm39) V107I probably null Het
Aftph T C 11: 20,676,144 (GRCm39) probably null Het
Agtpbp1 A T 13: 59,692,167 (GRCm39) probably null Het
Arhgap15 C A 2: 44,006,689 (GRCm39) P269T probably damaging Het
Arhgap30 T C 1: 171,235,297 (GRCm39) V557A probably damaging Het
Asb3 T A 11: 31,031,493 (GRCm39) M410K probably benign Het
B4galnt2 T C 11: 95,759,460 (GRCm39) probably null Het
Birc2 A G 9: 7,860,262 (GRCm39) probably null Het
Cav2 A T 6: 17,286,950 (GRCm39) N69Y probably damaging Het
Cc2d2b G A 19: 40,784,111 (GRCm39) C826Y probably benign Het
Cenpf T A 1: 189,385,051 (GRCm39) T2410S probably benign Het
Chchd1 A G 14: 20,753,448 (GRCm39) D24G probably benign Het
Cmip G A 8: 118,163,618 (GRCm39) G450S probably benign Het
Col11a1 C T 3: 114,006,099 (GRCm39) Q534* probably null Het
Col3a1 G T 1: 45,377,782 (GRCm39) probably benign Het
Cox4i1 T C 8: 121,399,969 (GRCm39) I31T possibly damaging Het
Cstf3 G T 2: 104,477,112 (GRCm39) V168F probably damaging Het
Dapk1 T C 13: 60,873,154 (GRCm39) I352T probably benign Het
Ddx52 T C 11: 83,846,128 (GRCm39) V456A probably damaging Het
Dmxl2 A T 9: 54,323,372 (GRCm39) H1337Q probably damaging Het
Dnah7a T C 1: 53,675,221 (GRCm39) T369A probably benign Het
Dppa1 T A 11: 46,516,422 (GRCm39) I8F unknown Het
Ebf1 G T 11: 44,774,641 (GRCm39) V213F probably damaging Het
Foxb2 C A 19: 16,850,197 (GRCm39) E270* probably null Het
Gclc A T 9: 77,695,527 (GRCm39) R450W probably damaging Het
Grin2d T C 7: 45,511,692 (GRCm39) E251G probably damaging Het
Hal A T 10: 93,336,539 (GRCm39) N423Y probably damaging Het
Krtap4-8 T A 11: 99,670,917 (GRCm39) I185F unknown Het
Lrp3 T A 7: 34,910,862 (GRCm39) Q61L probably benign Het
Met A C 6: 17,571,466 (GRCm39) Q1296H probably damaging Het
Mphosph9 T A 5: 124,435,762 (GRCm39) N557I possibly damaging Het
Mrpl46 C A 7: 78,432,729 (GRCm39) W16C probably benign Het
Myh13 G A 11: 67,241,245 (GRCm39) R874Q probably damaging Het
Nelfb G A 2: 25,093,393 (GRCm39) T453I probably benign Het
Nos2 A G 11: 78,843,780 (GRCm39) D909G probably damaging Het
Nr5a2 T C 1: 136,810,082 (GRCm39) E431G possibly damaging Het
Nsmce2 A G 15: 59,463,573 (GRCm39) D149G probably benign Het
Or52b1 C T 7: 104,979,234 (GRCm39) R55H probably benign Het
Or5ac21 T C 16: 59,124,004 (GRCm39) F164L probably benign Het
Pcbp4 C A 9: 106,337,847 (GRCm39) probably null Het
Peg10 A G 6: 4,757,137 (GRCm39) probably benign Het
Pms2 C T 5: 143,862,237 (GRCm39) P154L probably benign Het
Pou6f2 A C 13: 18,303,772 (GRCm39) L112R probably benign Het
Pramel30 T C 4: 144,059,548 (GRCm39) W420R probably benign Het
Prdm6 A T 18: 53,598,118 (GRCm39) probably benign Het
Prob1 G A 18: 35,788,207 (GRCm39) R12W probably damaging Het
Rif1 T A 2: 51,968,275 (GRCm39) probably null Het
Rpl9-ps6 A G 19: 32,443,543 (GRCm39) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sec23ip A G 7: 128,354,573 (GRCm39) silent Het
Slc38a9 T C 13: 112,826,714 (GRCm39) C151R probably benign Het
Slc39a8 T C 3: 135,554,941 (GRCm39) probably null Het
Slc6a18 C A 13: 73,826,110 (GRCm39) probably benign Het
Snw1 T C 12: 87,511,480 (GRCm39) D57G probably damaging Het
Sox6 C G 7: 115,140,966 (GRCm39) R505P probably damaging Het
Speg T C 1: 75,387,039 (GRCm39) probably null Het
Spire2 C T 8: 124,083,585 (GRCm39) R190C probably damaging Het
Stard9 A C 2: 120,528,864 (GRCm39) H1707P possibly damaging Het
Tenm3 G T 8: 48,796,278 (GRCm39) T237K probably damaging Het
Themis2 T A 4: 132,523,573 (GRCm39) E31V possibly damaging Het
Trim56 T G 5: 137,143,375 (GRCm39) Q47P probably damaging Het
Trim58 T C 11: 58,542,090 (GRCm39) I350T probably benign Het
Ubxn6 A G 17: 56,377,650 (GRCm39) probably null Het
Vmn2r114 A T 17: 23,528,850 (GRCm39) F417L probably benign Het
Vmn2r29 T A 7: 7,234,421 (GRCm39) M822L probably benign Het
Vps9d1 T C 8: 123,980,746 (GRCm39) D27G probably damaging Het
Wdr3 C T 3: 100,046,040 (GRCm39) R931Q probably damaging Het
Whamm G A 7: 81,228,050 (GRCm39) probably null Het
Zcchc24 T C 14: 25,757,457 (GRCm39) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm39) K2050R probably damaging Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146,615,337 (GRCm39) missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146,667,474 (GRCm39) missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146,615,354 (GRCm39) missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146,645,776 (GRCm39) missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146,602,445 (GRCm39) missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146,615,408 (GRCm39) missense probably benign 0.06
P0038:Ttll7 UTSW 3 146,650,939 (GRCm39) missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146,649,915 (GRCm39) nonsense probably null
R0358:Ttll7 UTSW 3 146,649,871 (GRCm39) missense probably benign
R0363:Ttll7 UTSW 3 146,649,970 (GRCm39) missense probably benign 0.00
R0364:Ttll7 UTSW 3 146,650,936 (GRCm39) missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146,645,746 (GRCm39) missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146,645,746 (GRCm39) missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146,602,422 (GRCm39) missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146,600,160 (GRCm39) missense probably benign 0.02
R1789:Ttll7 UTSW 3 146,621,535 (GRCm39) missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146,621,550 (GRCm39) splice site probably benign
R1995:Ttll7 UTSW 3 146,667,510 (GRCm39) missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146,635,859 (GRCm39) missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146,635,944 (GRCm39) missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146,653,376 (GRCm39) missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146,636,170 (GRCm39) nonsense probably null
R4888:Ttll7 UTSW 3 146,599,932 (GRCm39) start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146,600,224 (GRCm39) missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146,667,465 (GRCm39) missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146,649,847 (GRCm39) nonsense probably null
R6009:Ttll7 UTSW 3 146,640,290 (GRCm39) missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146,645,917 (GRCm39) missense probably benign
R6036:Ttll7 UTSW 3 146,645,917 (GRCm39) missense probably benign
R6463:Ttll7 UTSW 3 146,637,337 (GRCm39) missense possibly damaging 0.86
R6922:Ttll7 UTSW 3 146,615,369 (GRCm39) missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146,619,051 (GRCm39) missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146,619,031 (GRCm39) missense probably damaging 0.97
R8229:Ttll7 UTSW 3 146,607,204 (GRCm39) missense probably damaging 0.99
R8406:Ttll7 UTSW 3 146,645,779 (GRCm39) missense probably benign
R9343:Ttll7 UTSW 3 146,667,497 (GRCm39) missense probably damaging 1.00
R9348:Ttll7 UTSW 3 146,673,768 (GRCm39) missense probably benign 0.31
R9629:Ttll7 UTSW 3 146,621,487 (GRCm39) missense probably damaging 1.00
RF015:Ttll7 UTSW 3 146,685,413 (GRCm39) missense probably benign 0.00
X0024:Ttll7 UTSW 3 146,615,308 (GRCm39) missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146,667,450 (GRCm39) missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146,653,408 (GRCm39) missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146,653,390 (GRCm39) missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146,635,933 (GRCm39) missense probably benign 0.01
Z1176:Ttll7 UTSW 3 146,621,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTTCTCTCCTAGCGATGG -3'
(R):5'- TCTCCAACTGCATCGAGTACAG -3'

Sequencing Primer
(F):5'- CTCCTAGCGATGGTGTCTAGAC -3'
(R):5'- CAACTGCATCGAGTACAGTGTTC -3'
Posted On 2018-08-01