Mutagenetix > Incidental Mutation

Incidental Mutation 'R6747:Mphosph9'

530576

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

044864-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124297699 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 557 (N557I)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031344
AA Change: N527I

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: N527I

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130502

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

possibly damaging
Transcript: ENSMUST00000184951
AA Change: N557I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: N557I

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200448

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (68/70)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,126,313		probably null	Het
Acyp1	C	T	12: 85,278,905	V107I	probably null	Het
Aftph	T	C	11: 20,726,144		probably null	Het
Agtpbp1	A	T	13: 59,544,353		probably null	Het
Arhgap15	C	A	2: 44,116,677	P269T	probably damaging	Het
Arhgap30	T	C	1: 171,407,729	V557A	probably damaging	Het
Asb3	T	A	11: 31,081,493	M410K	probably benign	Het
B4galnt2	T	C	11: 95,868,634		probably null	Het
Birc3	A	G	9: 7,860,261		probably null	Het
Cav2	A	T	6: 17,286,951	N69Y	probably damaging	Het
Cc2d2b	G	A	19: 40,795,667	C826Y	probably benign	Het
Cenpf	T	A	1: 189,652,854	T2410S	probably benign	Het
Chchd1	A	G	14: 20,703,380	D24G	probably benign	Het
Cmip	G	A	8: 117,436,879	G450S	probably benign	Het
Col11a1	C	T	3: 114,212,450	Q534*	probably null	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Cox4i1	T	C	8: 120,673,230	I31T	possibly damaging	Het
Cstf3	G	T	2: 104,646,767	V168F	probably damaging	Het
Dapk1	T	C	13: 60,725,340	I352T	probably benign	Het
Ddx52	T	C	11: 83,955,302	V456A	probably damaging	Het
Dmxl2	A	T	9: 54,416,088	H1337Q	probably damaging	Het
Dnah7a	T	C	1: 53,636,062	T369A	probably benign	Het
Dppa1	T	A	11: 46,625,595	I8F	unknown	Het
Ebf1	G	T	11: 44,883,814	V213F	probably damaging	Het
Foxb2	C	A	19: 16,872,833	E270*	probably null	Het
Gclc	A	T	9: 77,788,245	R450W	probably damaging	Het
Gm13128	T	C	4: 144,332,978	W420R	probably benign	Het
Grin2d	T	C	7: 45,862,268	E251G	probably damaging	Het
Hal	A	T	10: 93,500,677	N423Y	probably damaging	Het
Krtap4-8	T	A	11: 99,780,091	I185F	unknown	Het
Lrp3	T	A	7: 35,211,437	Q61L	probably benign	Het
Met	A	C	6: 17,571,467	Q1296H	probably damaging	Het
Mrpl46	C	A	7: 78,782,981	W16C	probably benign	Het
Myh13	G	A	11: 67,350,419	R874Q	probably damaging	Het
Nelfb	G	A	2: 25,203,381	T453I	probably benign	Het
Nos2	A	G	11: 78,952,954	D909G	probably damaging	Het
Nr5a2	T	C	1: 136,882,344	E431G	possibly damaging	Het
Nsmce2	A	G	15: 59,591,724	D149G	probably benign	Het
Olfr203	T	C	16: 59,303,641	F164L	probably benign	Het
Olfr690	C	T	7: 105,330,027	R55H	probably benign	Het
Pcbp4	C	A	9: 106,460,648		probably null	Het
Peg10	A	G	6: 4,757,137		probably benign	Het
Pms2	C	T	5: 143,925,419	P154L	probably benign	Het
Pou6f2	A	C	13: 18,129,187	L112R	probably benign	Het
Prdm6	A	T	18: 53,465,046		probably benign	Het
Prob1	G	A	18: 35,655,154	R12W	probably damaging	Het
Rif1	T	A	2: 52,078,263		probably null	Het
Rpl9-ps6	A	G	19: 32,466,143	S137P	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Homo
Sec23ip	A	G	7: 128,752,849		silent	Het
Slc38a9	T	C	13: 112,690,180	C151R	probably benign	Het
Slc39a8	T	C	3: 135,849,180		probably null	Het
Slc6a18	C	A	13: 73,677,991		probably benign	Het
Snw1	T	C	12: 87,464,710	D57G	probably damaging	Het
Sox6	C	G	7: 115,541,731	R505P	probably damaging	Het
Speg	T	C	1: 75,410,395		probably null	Het
Spire2	C	T	8: 123,356,846	R190C	probably damaging	Het
Stard9	A	C	2: 120,698,383	H1707P	possibly damaging	Het
Tenm3	G	T	8: 48,343,243	T237K	probably damaging	Het
Themis2	T	A	4: 132,796,262	E31V	possibly damaging	Het
Trim56	T	G	5: 137,114,521	Q47P	probably damaging	Het
Trim58	T	C	11: 58,651,264	I350T	probably benign	Het
Ttll7	C	T	3: 146,944,056	P639S	probably benign	Het
Ubxn6	A	G	17: 56,070,650		probably null	Het
Vmn2r114	A	T	17: 23,309,876	F417L	probably benign	Het
Vmn2r29	T	A	7: 7,231,422	M822L	probably benign	Het
Vps9d1	T	C	8: 123,254,007	D27G	probably damaging	Het
Wdr3	C	T	3: 100,138,724	R931Q	probably damaging	Het
Whamm	G	A	7: 81,578,302		probably null	Het
Zcchc24	T	C	14: 25,757,033	H142R	probably damaging	Het
Zfp292	T	C	4: 34,806,894	K2050R	probably damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10
R9603:Mphosph9	UTSW	5	124324952	nonsense	probably null
R9721:Mphosph9	UTSW	5	124298675	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GGAGAAACATTAGCCCTCTGG -3'
(R):5'- TCGGGCTAGGAGAATGACTG -3'

Sequencing Primer
(F):5'- TGGGAGTCTCACCTGTCC -3'
(R):5'- CCCGGCTGTAACATCTTAATGAGG -3'

Posted On

2018-08-01