Incidental Mutation 'R6747:Pms2'
ID530578
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene NamePMS1 homolog2, mismatch repair system component
Synonymsmismatch repair, DNA mismatch repair
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143909964-143933968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143925419 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 154 (P154L)
Ref Sequence ENSEMBL: ENSMUSP00000133062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110707
Predicted Effect probably benign
Transcript: ENSMUST00000110709
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141942
Predicted Effect probably benign
Transcript: ENSMUST00000148011
AA Change: P448L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: P448L

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164999
AA Change: P154L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109
AA Change: P154L

DomainStartEndE-ValueType
DNA_mis_repair 1 70 4.47e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170083
Predicted Effect probably benign
Transcript: ENSMUST00000172367
SMART Domains Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

DomainStartEndE-ValueType
MutL_C 5 139 1.78e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143923519 missense probably damaging 1.00
IGL02009:Pms2 APN 5 143925764 missense probably benign 0.42
IGL02801:Pms2 APN 5 143925835 missense probably benign 0.06
P0047:Pms2 UTSW 5 143919598 missense probably damaging 1.00
R1367:Pms2 UTSW 5 143925913 missense probably damaging 1.00
R1422:Pms2 UTSW 5 143913705 missense probably damaging 1.00
R1854:Pms2 UTSW 5 143925896 missense probably benign 0.08
R1997:Pms2 UTSW 5 143913700 missense probably damaging 1.00
R2248:Pms2 UTSW 5 143916506 missense probably damaging 1.00
R2873:Pms2 UTSW 5 143911914 splice site probably benign
R4072:Pms2 UTSW 5 143929001 missense probably damaging 0.99
R4082:Pms2 UTSW 5 143931019 missense probably damaging 1.00
R4358:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R5100:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5101:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5228:Pms2 UTSW 5 143923597 missense probably damaging 0.99
R5484:Pms2 UTSW 5 143928125 missense probably damaging 1.00
R6310:Pms2 UTSW 5 143923583 missense probably benign 0.06
R6331:Pms2 UTSW 5 143914633 missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143928968 missense probably damaging 0.99
R6718:Pms2 UTSW 5 143923489 missense probably damaging 0.98
R6980:Pms2 UTSW 5 143912024 missense probably benign 0.21
R7207:Pms2 UTSW 5 143913634 missense probably damaging 1.00
R7349:Pms2 UTSW 5 143925836 missense probably benign 0.11
R7657:Pms2 UTSW 5 143919539 missense possibly damaging 0.93
R7820:Pms2 UTSW 5 143914633 missense possibly damaging 0.80
X0064:Pms2 UTSW 5 143916466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACTAGAAAAGCCTGTGCCAG -3'
(R):5'- AGCTCACGTTATAGTCACTGC -3'

Sequencing Primer
(F):5'- GTGCCAGGAAAGCAAGATAACTCTC -3'
(R):5'- TAGTCACTGCTAAAGCTACTGGC -3'
Posted On2018-08-01