Mutagenetix > Incidental Mutations

Incidental Mutation 'R6747:Pms2'

530578

Institutional Source

Beutler Lab

Gene Symbol

Pms2

Ensembl Gene

ENSMUSG00000079109

Gene Name

PMS1 homolog2, mismatch repair system component

Synonyms

mismatch repair, DNA mismatch repair

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.486) question?

Stock #

R6747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143909964-143933968 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 143925419 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 154 (P154L)

Ref Sequence

ENSEMBL: ENSMUSP00000133062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110707

Predicted Effect

probably benign
Transcript: ENSMUST00000110709

SMART Domains

Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
MutL_C	277	421	1.59e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141942

Predicted Effect

probably benign
Transcript: ENSMUST00000148011
AA Change: P448L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: P448L

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
DNA_mis_repair	227	364	4.76e-41	SMART
MutL_C	675	819	1.59e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164999
AA Change: P154L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109
AA Change: P154L

Domain	Start	End	E-Value	Type
DNA_mis_repair	1	70	4.47e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170083

Predicted Effect

probably benign
Transcript: ENSMUST00000172367

SMART Domains

Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

Domain	Start	End	E-Value	Type
MutL_C	5	139	1.78e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,126,313		probably null	Het
Acyp1	C	T	12: 85,278,905	V107I	probably null	Het
Aftph	T	C	11: 20,726,144		probably null	Het
Agtpbp1	A	T	13: 59,544,353		probably null	Het
Arhgap15	C	A	2: 44,116,677	P269T	probably damaging	Het
Arhgap30	T	C	1: 171,407,729	V557A	probably damaging	Het
Asb3	T	A	11: 31,081,493	M410K	probably benign	Het
B4galnt2	T	C	11: 95,868,634		probably null	Het
Birc3	A	G	9: 7,860,261		probably null	Het
Cav2	A	T	6: 17,286,951	N69Y	probably damaging	Het
Cc2d2b	G	A	19: 40,795,667	C826Y	probably benign	Het
Cenpf	T	A	1: 189,652,854	T2410S	probably benign	Het
Chchd1	A	G	14: 20,703,380	D24G	probably benign	Het
Cmip	G	A	8: 117,436,879	G450S	probably benign	Het
Col11a1	C	T	3: 114,212,450	Q534*	probably null	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Cox4i1	T	C	8: 120,673,230	I31T	possibly damaging	Het
Cstf3	G	T	2: 104,646,767	V168F	probably damaging	Het
Dapk1	T	C	13: 60,725,340	I352T	probably benign	Het
Ddx52	T	C	11: 83,955,302	V456A	probably damaging	Het
Dmxl2	A	T	9: 54,416,088	H1337Q	probably damaging	Het
Dnah7a	T	C	1: 53,636,062	T369A	probably benign	Het
Dppa1	T	A	11: 46,625,595	I8F	unknown	Het
Ebf1	G	T	11: 44,883,814	V213F	probably damaging	Het
Foxb2	C	A	19: 16,872,833	E270*	probably null	Het
Gclc	A	T	9: 77,788,245	R450W	probably damaging	Het
Gm13128	T	C	4: 144,332,978	W420R	probably benign	Het
Grin2d	T	C	7: 45,862,268	E251G	probably damaging	Het
Hal	A	T	10: 93,500,677	N423Y	probably damaging	Het
Krtap4-8	T	A	11: 99,780,091	I185F	unknown	Het
Lrp3	T	A	7: 35,211,437	Q61L	probably benign	Het
Met	A	C	6: 17,571,467	Q1296H	probably damaging	Het
Mphosph9	T	A	5: 124,297,699	N557I	possibly damaging	Het
Mrpl46	C	A	7: 78,782,981	W16C	probably benign	Het
Myh13	G	A	11: 67,350,419	R874Q	probably damaging	Het
Nelfb	G	A	2: 25,203,381	T453I	probably benign	Het
Nos2	A	G	11: 78,952,954	D909G	probably damaging	Het
Nr5a2	T	C	1: 136,882,344	E431G	possibly damaging	Het
Nsmce2	A	G	15: 59,591,724	D149G	probably benign	Het
Olfr203	T	C	16: 59,303,641	F164L	probably benign	Het
Olfr690	C	T	7: 105,330,027	R55H	probably benign	Het
Pcbp4	C	A	9: 106,460,648		probably null	Het
Peg10	A	G	6: 4,757,137		probably benign	Het
Pou6f2	A	C	13: 18,129,187	L112R	probably benign	Het
Prdm6	A	T	18: 53,465,046		probably benign	Het
Prob1	G	A	18: 35,655,154	R12W	probably damaging	Het
Rif1	T	A	2: 52,078,263		probably null	Het
Rpl9-ps6	A	G	19: 32,466,143	S137P	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Homo
Sec23ip	A	G	7: 128,752,849		silent	Het
Slc38a9	T	C	13: 112,690,180	C151R	probably benign	Het
Slc39a8	T	C	3: 135,849,180		probably null	Het
Slc6a18	C	A	13: 73,677,991		probably benign	Het
Snw1	T	C	12: 87,464,710	D57G	probably damaging	Het
Sox6	C	G	7: 115,541,731	R505P	probably damaging	Het
Speg	T	C	1: 75,410,395		probably null	Het
Spire2	C	T	8: 123,356,846	R190C	probably damaging	Het
Stard9	A	C	2: 120,698,383	H1707P	possibly damaging	Het
Tenm3	G	T	8: 48,343,243	T237K	probably damaging	Het
Themis2	T	A	4: 132,796,262	E31V	possibly damaging	Het
Trim56	T	G	5: 137,114,521	Q47P	probably damaging	Het
Trim58	T	C	11: 58,651,264	I350T	probably benign	Het
Ttll7	C	T	3: 146,944,056	P639S	probably benign	Het
Ubxn6	A	G	17: 56,070,650		probably null	Het
Vmn2r114	A	T	17: 23,309,876	F417L	probably benign	Het
Vmn2r29	T	A	7: 7,231,422	M822L	probably benign	Het
Vps9d1	T	C	8: 123,254,007	D27G	probably damaging	Het
Wdr3	C	T	3: 100,138,724	R931Q	probably damaging	Het
Whamm	G	A	7: 81,578,302		probably null	Het
Zcchc24	T	C	14: 25,757,033	H142R	probably damaging	Het
Zfp292	T	C	4: 34,806,894	K2050R	probably damaging	Het

Other mutations in Pms2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01893:Pms2	APN	5	143923519	missense	probably damaging	1.00
IGL02009:Pms2	APN	5	143925764	missense	probably benign	0.42
IGL02801:Pms2	APN	5	143925835	missense	probably benign	0.06
P0047:Pms2	UTSW	5	143919598	missense	probably damaging	1.00
R1367:Pms2	UTSW	5	143925913	missense	probably damaging	1.00
R1422:Pms2	UTSW	5	143913705	missense	probably damaging	1.00
R1854:Pms2	UTSW	5	143925896	missense	probably benign	0.08
R1997:Pms2	UTSW	5	143913700	missense	probably damaging	1.00
R2248:Pms2	UTSW	5	143916506	missense	probably damaging	1.00
R2873:Pms2	UTSW	5	143911914	splice site	probably benign
R4072:Pms2	UTSW	5	143929001	missense	probably damaging	0.99
R4082:Pms2	UTSW	5	143931019	missense	probably damaging	1.00
R4358:Pms2	UTSW	5	143925926	missense	probably damaging	1.00
R5100:Pms2	UTSW	5	143928188	missense	probably damaging	1.00
R5101:Pms2	UTSW	5	143928188	missense	probably damaging	1.00
R5228:Pms2	UTSW	5	143923597	missense	probably damaging	0.99
R5484:Pms2	UTSW	5	143928125	missense	probably damaging	1.00
R6310:Pms2	UTSW	5	143923583	missense	probably benign	0.06
R6331:Pms2	UTSW	5	143914633	missense	possibly damaging	0.94
R6567:Pms2	UTSW	5	143928968	missense	probably damaging	0.99
R6718:Pms2	UTSW	5	143923489	missense	probably damaging	0.98
R6980:Pms2	UTSW	5	143912024	missense	probably benign	0.21
R7207:Pms2	UTSW	5	143913634	missense	probably damaging	1.00
R7349:Pms2	UTSW	5	143925836	missense	probably benign	0.11
R7657:Pms2	UTSW	5	143919539	missense	possibly damaging	0.93
R7820:Pms2	UTSW	5	143914633	missense	possibly damaging	0.80
R7980:Pms2	UTSW	5	143931091	missense	probably damaging	1.00
R8213:Pms2	UTSW	5	143914771	missense	probably damaging	1.00
R8534:Pms2	UTSW	5	143923627	missense	probably benign	0.16
X0064:Pms2	UTSW	5	143916466	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAACTAGAAAAGCCTGTGCCAG -3'
(R):5'- AGCTCACGTTATAGTCACTGC -3'

Sequencing Primer
(F):5'- GTGCCAGGAAAGCAAGATAACTCTC -3'
(R):5'- TAGTCACTGCTAAAGCTACTGGC -3'

Posted On

2018-08-01