Incidental Mutation 'R6747:Pms2'
ID 530578
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene Name PMS1 homolog2, mismatch repair system component
Synonyms mismatch repair, DNA mismatch repair
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # R6747 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 143846782-143870786 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 143862237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 154 (P154L)
Ref Sequence ENSEMBL: ENSMUSP00000133062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110707
Predicted Effect probably benign
Transcript: ENSMUST00000110709
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141942
Predicted Effect probably benign
Transcript: ENSMUST00000148011
AA Change: P448L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: P448L

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164999
AA Change: P154L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109
AA Change: P154L

DomainStartEndE-ValueType
DNA_mis_repair 1 70 4.47e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170083
Predicted Effect probably benign
Transcript: ENSMUST00000172367
SMART Domains Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

DomainStartEndE-ValueType
MutL_C 5 139 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 121,919,962 (GRCm39) probably null Het
Acyp1 C T 12: 85,325,679 (GRCm39) V107I probably null Het
Aftph T C 11: 20,676,144 (GRCm39) probably null Het
Agtpbp1 A T 13: 59,692,167 (GRCm39) probably null Het
Arhgap15 C A 2: 44,006,689 (GRCm39) P269T probably damaging Het
Arhgap30 T C 1: 171,235,297 (GRCm39) V557A probably damaging Het
Asb3 T A 11: 31,031,493 (GRCm39) M410K probably benign Het
B4galnt2 T C 11: 95,759,460 (GRCm39) probably null Het
Birc2 A G 9: 7,860,262 (GRCm39) probably null Het
Cav2 A T 6: 17,286,950 (GRCm39) N69Y probably damaging Het
Cc2d2b G A 19: 40,784,111 (GRCm39) C826Y probably benign Het
Cenpf T A 1: 189,385,051 (GRCm39) T2410S probably benign Het
Chchd1 A G 14: 20,753,448 (GRCm39) D24G probably benign Het
Cmip G A 8: 118,163,618 (GRCm39) G450S probably benign Het
Col11a1 C T 3: 114,006,099 (GRCm39) Q534* probably null Het
Col3a1 G T 1: 45,377,782 (GRCm39) probably benign Het
Cox4i1 T C 8: 121,399,969 (GRCm39) I31T possibly damaging Het
Cstf3 G T 2: 104,477,112 (GRCm39) V168F probably damaging Het
Dapk1 T C 13: 60,873,154 (GRCm39) I352T probably benign Het
Ddx52 T C 11: 83,846,128 (GRCm39) V456A probably damaging Het
Dmxl2 A T 9: 54,323,372 (GRCm39) H1337Q probably damaging Het
Dnah7a T C 1: 53,675,221 (GRCm39) T369A probably benign Het
Dppa1 T A 11: 46,516,422 (GRCm39) I8F unknown Het
Ebf1 G T 11: 44,774,641 (GRCm39) V213F probably damaging Het
Foxb2 C A 19: 16,850,197 (GRCm39) E270* probably null Het
Gclc A T 9: 77,695,527 (GRCm39) R450W probably damaging Het
Grin2d T C 7: 45,511,692 (GRCm39) E251G probably damaging Het
Hal A T 10: 93,336,539 (GRCm39) N423Y probably damaging Het
Krtap4-8 T A 11: 99,670,917 (GRCm39) I185F unknown Het
Lrp3 T A 7: 34,910,862 (GRCm39) Q61L probably benign Het
Met A C 6: 17,571,466 (GRCm39) Q1296H probably damaging Het
Mphosph9 T A 5: 124,435,762 (GRCm39) N557I possibly damaging Het
Mrpl46 C A 7: 78,432,729 (GRCm39) W16C probably benign Het
Myh13 G A 11: 67,241,245 (GRCm39) R874Q probably damaging Het
Nelfb G A 2: 25,093,393 (GRCm39) T453I probably benign Het
Nos2 A G 11: 78,843,780 (GRCm39) D909G probably damaging Het
Nr5a2 T C 1: 136,810,082 (GRCm39) E431G possibly damaging Het
Nsmce2 A G 15: 59,463,573 (GRCm39) D149G probably benign Het
Or52b1 C T 7: 104,979,234 (GRCm39) R55H probably benign Het
Or5ac21 T C 16: 59,124,004 (GRCm39) F164L probably benign Het
Pcbp4 C A 9: 106,337,847 (GRCm39) probably null Het
Peg10 A G 6: 4,757,137 (GRCm39) probably benign Het
Pou6f2 A C 13: 18,303,772 (GRCm39) L112R probably benign Het
Pramel30 T C 4: 144,059,548 (GRCm39) W420R probably benign Het
Prdm6 A T 18: 53,598,118 (GRCm39) probably benign Het
Prob1 G A 18: 35,788,207 (GRCm39) R12W probably damaging Het
Rif1 T A 2: 51,968,275 (GRCm39) probably null Het
Rpl9-ps6 A G 19: 32,443,543 (GRCm39) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sec23ip A G 7: 128,354,573 (GRCm39) silent Het
Slc38a9 T C 13: 112,826,714 (GRCm39) C151R probably benign Het
Slc39a8 T C 3: 135,554,941 (GRCm39) probably null Het
Slc6a18 C A 13: 73,826,110 (GRCm39) probably benign Het
Snw1 T C 12: 87,511,480 (GRCm39) D57G probably damaging Het
Sox6 C G 7: 115,140,966 (GRCm39) R505P probably damaging Het
Speg T C 1: 75,387,039 (GRCm39) probably null Het
Spire2 C T 8: 124,083,585 (GRCm39) R190C probably damaging Het
Stard9 A C 2: 120,528,864 (GRCm39) H1707P possibly damaging Het
Tenm3 G T 8: 48,796,278 (GRCm39) T237K probably damaging Het
Themis2 T A 4: 132,523,573 (GRCm39) E31V possibly damaging Het
Trim56 T G 5: 137,143,375 (GRCm39) Q47P probably damaging Het
Trim58 T C 11: 58,542,090 (GRCm39) I350T probably benign Het
Ttll7 C T 3: 146,649,811 (GRCm39) P639S probably benign Het
Ubxn6 A G 17: 56,377,650 (GRCm39) probably null Het
Vmn2r114 A T 17: 23,528,850 (GRCm39) F417L probably benign Het
Vmn2r29 T A 7: 7,234,421 (GRCm39) M822L probably benign Het
Vps9d1 T C 8: 123,980,746 (GRCm39) D27G probably damaging Het
Wdr3 C T 3: 100,046,040 (GRCm39) R931Q probably damaging Het
Whamm G A 7: 81,228,050 (GRCm39) probably null Het
Zcchc24 T C 14: 25,757,457 (GRCm39) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm39) K2050R probably damaging Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143,860,337 (GRCm39) missense probably damaging 1.00
IGL02009:Pms2 APN 5 143,862,582 (GRCm39) missense probably benign 0.42
IGL02801:Pms2 APN 5 143,862,653 (GRCm39) missense probably benign 0.06
P0047:Pms2 UTSW 5 143,856,416 (GRCm39) missense probably damaging 1.00
R1367:Pms2 UTSW 5 143,862,731 (GRCm39) missense probably damaging 1.00
R1422:Pms2 UTSW 5 143,850,523 (GRCm39) missense probably damaging 1.00
R1854:Pms2 UTSW 5 143,862,714 (GRCm39) missense probably benign 0.08
R1997:Pms2 UTSW 5 143,850,518 (GRCm39) missense probably damaging 1.00
R2248:Pms2 UTSW 5 143,853,324 (GRCm39) missense probably damaging 1.00
R2873:Pms2 UTSW 5 143,848,732 (GRCm39) splice site probably benign
R4072:Pms2 UTSW 5 143,865,819 (GRCm39) missense probably damaging 0.99
R4082:Pms2 UTSW 5 143,867,837 (GRCm39) missense probably damaging 1.00
R4358:Pms2 UTSW 5 143,862,744 (GRCm39) missense probably damaging 1.00
R5100:Pms2 UTSW 5 143,865,006 (GRCm39) missense probably damaging 1.00
R5101:Pms2 UTSW 5 143,865,006 (GRCm39) missense probably damaging 1.00
R5228:Pms2 UTSW 5 143,860,415 (GRCm39) missense probably damaging 0.99
R5484:Pms2 UTSW 5 143,864,943 (GRCm39) missense probably damaging 1.00
R6310:Pms2 UTSW 5 143,860,401 (GRCm39) missense probably benign 0.06
R6331:Pms2 UTSW 5 143,851,451 (GRCm39) missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143,865,786 (GRCm39) missense probably damaging 0.99
R6718:Pms2 UTSW 5 143,860,307 (GRCm39) missense probably damaging 0.98
R6980:Pms2 UTSW 5 143,848,842 (GRCm39) missense probably benign 0.21
R7207:Pms2 UTSW 5 143,850,452 (GRCm39) missense probably damaging 1.00
R7349:Pms2 UTSW 5 143,862,654 (GRCm39) missense probably benign 0.11
R7657:Pms2 UTSW 5 143,856,357 (GRCm39) missense possibly damaging 0.93
R7820:Pms2 UTSW 5 143,851,451 (GRCm39) missense possibly damaging 0.80
R7980:Pms2 UTSW 5 143,867,909 (GRCm39) missense probably damaging 1.00
R8213:Pms2 UTSW 5 143,851,589 (GRCm39) missense probably damaging 1.00
R8534:Pms2 UTSW 5 143,860,445 (GRCm39) missense probably benign 0.16
R9021:Pms2 UTSW 5 143,862,744 (GRCm39) missense probably damaging 1.00
R9218:Pms2 UTSW 5 143,867,945 (GRCm39) missense probably benign
R9494:Pms2 UTSW 5 143,853,214 (GRCm39) missense probably damaging 1.00
R9614:Pms2 UTSW 5 143,854,420 (GRCm39) missense probably benign 0.01
R9712:Pms2 UTSW 5 143,851,614 (GRCm39) missense probably damaging 0.99
X0064:Pms2 UTSW 5 143,853,284 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACTAGAAAAGCCTGTGCCAG -3'
(R):5'- AGCTCACGTTATAGTCACTGC -3'

Sequencing Primer
(F):5'- GTGCCAGGAAAGCAAGATAACTCTC -3'
(R):5'- TAGTCACTGCTAAAGCTACTGGC -3'
Posted On 2018-08-01