Mutagenetix > Incidental Mutations

Incidental Mutation 'R6747:Met'

530581

Institutional Source

Beutler Lab

Gene Symbol

Met

Ensembl Gene

ENSMUSG00000009376

Gene Name

met proto-oncogene

Synonyms

Par4, HGF receptor, c-Met

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17463800-17573980 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 17571467 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 1296 (Q1296H)

Ref Sequence

ENSEMBL: ENSMUSP00000111103 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080469
AA Change: Q1296H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: Q1296H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115442
AA Change: Q1296H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: Q1296H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115443
AA Change: Q1296H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: Q1296H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,126,313		probably null	Het
Acyp1	C	T	12: 85,278,905	V107I	probably null	Het
Aftph	T	C	11: 20,726,144		probably null	Het
Agtpbp1	A	T	13: 59,544,353		probably null	Het
Arhgap15	C	A	2: 44,116,677	P269T	probably damaging	Het
Arhgap30	T	C	1: 171,407,729	V557A	probably damaging	Het
Asb3	T	A	11: 31,081,493	M410K	probably benign	Het
B4galnt2	T	C	11: 95,868,634		probably null	Het
Birc3	A	G	9: 7,860,261		probably null	Het
Cav2	A	T	6: 17,286,951	N69Y	probably damaging	Het
Cc2d2b	G	A	19: 40,795,667	C826Y	probably benign	Het
Cenpf	T	A	1: 189,652,854	T2410S	probably benign	Het
Chchd1	A	G	14: 20,703,380	D24G	probably benign	Het
Cmip	G	A	8: 117,436,879	G450S	probably benign	Het
Col11a1	C	T	3: 114,212,450	Q534*	probably null	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Cox4i1	T	C	8: 120,673,230	I31T	possibly damaging	Het
Cstf3	G	T	2: 104,646,767	V168F	probably damaging	Het
Dapk1	T	C	13: 60,725,340	I352T	probably benign	Het
Ddx52	T	C	11: 83,955,302	V456A	probably damaging	Het
Dmxl2	A	T	9: 54,416,088	H1337Q	probably damaging	Het
Dnah7a	T	C	1: 53,636,062	T369A	probably benign	Het
Dppa1	T	A	11: 46,625,595	I8F	unknown	Het
Ebf1	G	T	11: 44,883,814	V213F	probably damaging	Het
Foxb2	C	A	19: 16,872,833	E270*	probably null	Het
Gclc	A	T	9: 77,788,245	R450W	probably damaging	Het
Gm13128	T	C	4: 144,332,978	W420R	probably benign	Het
Grin2d	T	C	7: 45,862,268	E251G	probably damaging	Het
Hal	A	T	10: 93,500,677	N423Y	probably damaging	Het
Krtap4-8	T	A	11: 99,780,091	I185F	unknown	Het
Lrp3	T	A	7: 35,211,437	Q61L	probably benign	Het
Mphosph9	T	A	5: 124,297,699	N557I	possibly damaging	Het
Mrpl46	C	A	7: 78,782,981	W16C	probably benign	Het
Myh13	G	A	11: 67,350,419	R874Q	probably damaging	Het
Nelfb	G	A	2: 25,203,381	T453I	probably benign	Het
Nos2	A	G	11: 78,952,954	D909G	probably damaging	Het
Nr5a2	T	C	1: 136,882,344	E431G	possibly damaging	Het
Nsmce2	A	G	15: 59,591,724	D149G	probably benign	Het
Olfr203	T	C	16: 59,303,641	F164L	probably benign	Het
Olfr690	C	T	7: 105,330,027	R55H	probably benign	Het
Pcbp4	C	A	9: 106,460,648		probably null	Het
Peg10	A	G	6: 4,757,137		probably benign	Het
Pms2	C	T	5: 143,925,419	P154L	probably benign	Het
Pou6f2	A	C	13: 18,129,187	L112R	probably benign	Het
Prdm6	A	T	18: 53,465,046		probably benign	Het
Prob1	G	A	18: 35,655,154	R12W	probably damaging	Het
Rif1	T	A	2: 52,078,263		probably null	Het
Rpl9-ps6	A	G	19: 32,466,143	S137P	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Homo
Sec23ip	A	G	7: 128,752,849		silent	Het
Slc38a9	T	C	13: 112,690,180	C151R	probably benign	Het
Slc39a8	T	C	3: 135,849,180		probably null	Het
Slc6a18	C	A	13: 73,677,991		probably benign	Het
Snw1	T	C	12: 87,464,710	D57G	probably damaging	Het
Sox6	C	G	7: 115,541,731	R505P	probably damaging	Het
Speg	T	C	1: 75,410,395		probably null	Het
Spire2	C	T	8: 123,356,846	R190C	probably damaging	Het
Stard9	A	C	2: 120,698,383	H1707P	possibly damaging	Het
Tenm3	G	T	8: 48,343,243	T237K	probably damaging	Het
Themis2	T	A	4: 132,796,262	E31V	possibly damaging	Het
Trim56	T	G	5: 137,114,521	Q47P	probably damaging	Het
Trim58	T	C	11: 58,651,264	I350T	probably benign	Het
Ttll7	C	T	3: 146,944,056	P639S	probably benign	Het
Ubxn6	A	G	17: 56,070,650		probably null	Het
Vmn2r114	A	T	17: 23,309,876	F417L	probably benign	Het
Vmn2r29	T	A	7: 7,231,422	M822L	probably benign	Het
Vps9d1	T	C	8: 123,254,007	D27G	probably damaging	Het
Wdr3	C	T	3: 100,138,724	R931Q	probably damaging	Het
Whamm	G	A	7: 81,578,302		probably null	Het
Zcchc24	T	C	14: 25,757,033	H142R	probably damaging	Het
Zfp292	T	C	4: 34,806,894	K2050R	probably damaging	Het

Other mutations in Met

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00533:Met	APN	6	17534937	unclassified	probably benign
IGL01066:Met	APN	6	17535105	critical splice donor site	probably null
IGL01344:Met	APN	6	17547032	missense	probably benign	0.44
IGL01413:Met	APN	6	17558896	splice site	probably benign
IGL01608:Met	APN	6	17558730	missense	probably damaging	1.00
IGL01613:Met	APN	6	17540577	missense	probably damaging	1.00
IGL01820:Met	APN	6	17534231	missense	possibly damaging	0.89
IGL01843:Met	APN	6	17491701	missense	probably damaging	1.00
IGL02014:Met	APN	6	17527257	splice site	probably benign
IGL02027:Met	APN	6	17563727	splice site	probably benign
IGL02243:Met	APN	6	17549094	missense	probably damaging	1.00
IGL02373:Met	APN	6	17491529	missense	probably damaging	1.00
IGL02616:Met	APN	6	17553347	missense	probably damaging	1.00
IGL02702:Met	APN	6	17534143	missense	possibly damaging	0.92
IGL02704:Met	APN	6	17491257	missense	possibly damaging	0.62
IGL02714:Met	APN	6	17491852	nonsense	probably null
IGL02936:Met	APN	6	17553397	missense	probably damaging	1.00
IGL02943:Met	APN	6	17535929	missense	possibly damaging	0.84
IGL03057:Met	APN	6	17558766	missense	probably damaging	1.00
IGL03124:Met	APN	6	17492078	missense	probably benign	0.27
IGL03171:Met	APN	6	17562273	splice site	probably benign
IGL03266:Met	APN	6	17540538	missense	possibly damaging	0.61
IGL03285:Met	APN	6	17553337	missense	probably damaging	0.98
R0453:Met	UTSW	6	17534198	missense	possibly damaging	0.88
R0543:Met	UTSW	6	17491970	missense	probably damaging	1.00
R0601:Met	UTSW	6	17555632	splice site	probably null
R0652:Met	UTSW	6	17491710	missense	probably benign	0.00
R0941:Met	UTSW	6	17491394	missense	probably damaging	1.00
R1142:Met	UTSW	6	17527183	nonsense	probably null
R1553:Met	UTSW	6	17491461	missense	probably benign	0.01
R1569:Met	UTSW	6	17531504	nonsense	probably null
R1744:Met	UTSW	6	17540646	missense	possibly damaging	0.47
R2224:Met	UTSW	6	17563722	splice site	probably null
R2308:Met	UTSW	6	17491742	missense	probably benign	0.00
R2369:Met	UTSW	6	17531528	missense	probably benign	0.04
R2393:Met	UTSW	6	17534198	missense	probably damaging	0.99
R2419:Met	UTSW	6	17535830	splice site	probably benign
R2483:Met	UTSW	6	17549086	missense	probably damaging	1.00
R2511:Met	UTSW	6	17491967	missense	probably damaging	1.00
R3622:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3623:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3624:Met	UTSW	6	17549086	missense	probably damaging	1.00
R4050:Met	UTSW	6	17533984	missense	probably benign
R4051:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4159:Met	UTSW	6	17562272	splice site	probably null
R4208:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4622:Met	UTSW	6	17513384	missense	probably benign	0.19
R4672:Met	UTSW	6	17571804	missense	probably benign	0.33
R4737:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4738:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4834:Met	UTSW	6	17491413	missense	probably damaging	0.97
R4846:Met	UTSW	6	17491929	missense	probably damaging	0.99
R4855:Met	UTSW	6	17558797	missense	probably damaging	1.00
R4878:Met	UTSW	6	17549059	missense	probably damaging	1.00
R4902:Met	UTSW	6	17546996	missense	probably damaging	1.00
R5208:Met	UTSW	6	17526423	nonsense	probably null
R5355:Met	UTSW	6	17491362	missense	probably damaging	1.00
R5415:Met	UTSW	6	17527085	missense	probably benign	0.01
R5556:Met	UTSW	6	17534176	missense	probably benign	0.04
R5590:Met	UTSW	6	17548782	missense	probably benign	0.00
R5683:Met	UTSW	6	17571744	missense	probably damaging	1.00
R5872:Met	UTSW	6	17562198	missense	probably damaging	1.00
R5891:Met	UTSW	6	17491539	missense	probably benign	0.02
R5895:Met	UTSW	6	17531582	missense	probably benign	0.02
R6063:Met	UTSW	6	17491968	missense	probably damaging	1.00
R6262:Met	UTSW	6	17553404	missense	probably benign	0.00
R6362:Met	UTSW	6	17558733	missense	probably damaging	1.00
R6966:Met	UTSW	6	17531532	missense	possibly damaging	0.65
R6989:Met	UTSW	6	17535928	missense	possibly damaging	0.67
R6989:Met	UTSW	6	17535929	missense	probably damaging	1.00
R7017:Met	UTSW	6	17491287	nonsense	probably null
R7037:Met	UTSW	6	17547128	intron	probably benign
R7141:Met	UTSW	6	17527155	missense	probably benign	0.01
R7242:Met	UTSW	6	17491317	missense	probably damaging	1.00
R7282:Met	UTSW	6	17547012	nonsense	probably null
R7624:Met	UTSW	6	17558835	missense	probably damaging	1.00
R7770:Met	UTSW	6	17491407	missense	possibly damaging	0.79
R7797:Met	UTSW	6	17533953	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGGTGTGAAGTGTGTCAAGC -3'
(R):5'- AAAAGGACGGGCGCATTTC -3'

Sequencing Primer
(F):5'- ATGAATTACGGAGAGCTACCGATTTC -3'
(R):5'- CGCATTTCCGCTTTGGG -3'

Posted On

2018-08-01