Incidental Mutation 'R6747:Mrpl46'
ID530585
Institutional Source Beutler Lab
Gene Symbol Mrpl46
Ensembl Gene ENSMUSG00000030612
Gene Namemitochondrial ribosomal protein L46
SynonymsP2ECSL, 3110052F15Rik, LIECG2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6747 (G1)
Quality Score139.008
Status Validated
Chromosome7
Chromosomal Location78775236-78783531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78782981 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 16 (W16C)
Ref Sequence ENSEMBL: ENSMUSP00000032841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032840] [ENSMUST00000032841] [ENSMUST00000133553]
Predicted Effect probably benign
Transcript: ENSMUST00000032840
SMART Domains Protein: ENSMUSP00000032840
Gene: ENSMUSG00000030611

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 81 190 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032841
AA Change: W16C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000032841
Gene: ENSMUSG00000030612
AA Change: W16C

DomainStartEndE-ValueType
Pfam:MRP-L46 43 139 2e-22 PFAM
SCOP:d1ktga_ 152 276 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133304
Predicted Effect probably benign
Transcript: ENSMUST00000133553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205558
Meta Mutation Damage Score 0.2494 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Mrpl46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Mrpl46 APN 7 78782976 missense probably benign 0.20
IGL02951:Mrpl46 APN 7 78775452 utr 3 prime probably benign
IGL03085:Mrpl46 APN 7 78781585 missense probably damaging 0.98
R0669:Mrpl46 UTSW 7 78782883 nonsense probably null
R1958:Mrpl46 UTSW 7 78781398 critical splice donor site probably null
R2047:Mrpl46 UTSW 7 78781564 missense probably damaging 0.99
R4814:Mrpl46 UTSW 7 78780595 missense probably benign 0.08
R5568:Mrpl46 UTSW 7 78780494 missense probably damaging 1.00
R7252:Mrpl46 UTSW 7 78780588 missense probably benign 0.01
R7253:Mrpl46 UTSW 7 78781459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACCTGCTGTAATAGACCC -3'
(R):5'- GGAACTTTCCCCTTTCTAGTGG -3'

Sequencing Primer
(F):5'- TGCTGTAATAGACCCGCCATC -3'
(R):5'- GTGGTCTAACACTAGAATTTCACC -3'
Posted On2018-08-01