Incidental Mutation 'R6747:Whamm'
ID530586
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene NameWAS protein homolog associated with actin, golgi membranes and microtubules
SynonymsWhdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81571266-81596836 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 81578302 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
Predicted Effect probably null
Transcript: ENSMUST00000165460
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207123
Predicted Effect probably null
Transcript: ENSMUST00000209044
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81578266 missense probably damaging 1.00
IGL01139:Whamm APN 7 81595914 missense probably damaging 1.00
IGL01870:Whamm APN 7 81595974 missense probably damaging 0.96
IGL03153:Whamm APN 7 81589532 splice site probably benign
R0179:Whamm UTSW 7 81594015 missense probably benign 0.00
R0364:Whamm UTSW 7 81594051 missense probably benign 0.00
R0550:Whamm UTSW 7 81586224 missense possibly damaging 0.55
R0682:Whamm UTSW 7 81586138 missense probably damaging 1.00
R1388:Whamm UTSW 7 81586290 missense probably damaging 1.00
R1940:Whamm UTSW 7 81578299 missense probably null 0.94
R1991:Whamm UTSW 7 81591771 nonsense probably null
R1992:Whamm UTSW 7 81591771 nonsense probably null
R2103:Whamm UTSW 7 81591771 nonsense probably null
R2104:Whamm UTSW 7 81591771 nonsense probably null
R2162:Whamm UTSW 7 81571341 missense probably damaging 1.00
R2291:Whamm UTSW 7 81591771 nonsense probably null
R3078:Whamm UTSW 7 81571784 missense probably damaging 1.00
R4735:Whamm UTSW 7 81571374 missense probably benign 0.01
R6336:Whamm UTSW 7 81591764 missense probably damaging 1.00
R6723:Whamm UTSW 7 81596120 missense probably damaging 1.00
R7029:Whamm UTSW 7 81591826 missense probably benign 0.09
R7286:Whamm UTSW 7 81586247 missense probably damaging 0.98
R7525:Whamm UTSW 7 81593850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTTACAGCAGTCCACAC -3'
(R):5'- ACCACTTATGATGGCTGAACAAAC -3'

Sequencing Primer
(F):5'- CAGACACTTCAGCATTTCCTAATGG -3'
(R):5'- CTTATGATGGCTGAACAAACACATC -3'
Posted On2018-08-01