Incidental Mutation 'R6747:Olfr690'
ID530588
Institutional Source Beutler Lab
Gene Symbol Olfr690
Ensembl Gene ENSMUSG00000050266
Gene Nameolfactory receptor 690
SynonymsGA_x6K02T2PBJ9-7959171-7958224, MOR31-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105328225-105334104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105330027 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 55 (R55H)
Ref Sequence ENSEMBL: ENSMUSP00000150831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061920] [ENSMUST00000211006] [ENSMUST00000216230]
Predicted Effect probably benign
Transcript: ENSMUST00000061920
AA Change: R55H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000061272
Gene: ENSMUSG00000050266
AA Change: R55H

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 33 312 2e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.4e-9 PFAM
Pfam:7tm_1 43 294 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209868
Predicted Effect probably benign
Transcript: ENSMUST00000211006
AA Change: R55H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000216230
AA Change: R55H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Olfr690
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Olfr690 APN 7 105329382 missense possibly damaging 0.95
IGL01403:Olfr690 APN 7 105329398 missense probably benign 0.01
IGL01546:Olfr690 APN 7 105329692 missense probably damaging 1.00
IGL02936:Olfr690 APN 7 105330005 nonsense probably null
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R1425:Olfr690 UTSW 7 105329715 missense probably damaging 1.00
R1911:Olfr690 UTSW 7 105329383 missense probably benign 0.11
R2126:Olfr690 UTSW 7 105329252 nonsense probably null
R2511:Olfr690 UTSW 7 105329610 missense probably damaging 1.00
R2919:Olfr690 UTSW 7 105329860 missense probably damaging 1.00
R3755:Olfr690 UTSW 7 105330151 missense probably damaging 1.00
R4152:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4153:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4154:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4247:Olfr690 UTSW 7 105330148 missense probably benign
R5015:Olfr690 UTSW 7 105329604 missense possibly damaging 0.61
R5143:Olfr690 UTSW 7 105329524 missense probably damaging 1.00
R5642:Olfr690 UTSW 7 105329565 missense probably damaging 1.00
R6961:Olfr690 UTSW 7 105329706 missense probably damaging 1.00
R7074:Olfr690 UTSW 7 105329268 missense probably benign 0.44
R8066:Olfr690 UTSW 7 105329554 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAAATGCCATGGCCAGAAGG -3'
(R):5'- TTTAGTCGTCACGGGAAGAATTC -3'

Sequencing Primer
(F):5'- ATGGCCAGAAGGATTCCCGAC -3'
(R):5'- TCGTCACGGGAAGAATTCAAAAGC -3'
Posted On2018-08-01