Mutagenetix > Incidental Mutations

Incidental Mutation 'R6747:Sox6'

530589

Institutional Source

Beutler Lab

Gene Symbol

Sox6

Ensembl Gene

ENSMUSG00000051910

Gene Name

SRY (sex determining region Y)-box 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115470872-116038796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 115541731 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 505 (R505P)

Ref Sequence

ENSEMBL: ENSMUSP00000145931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072804
AA Change: R504P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: R504P

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106612
AA Change: R462P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: R462P

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
low complexity region	420	442	N/A	INTRINSIC
low complexity region	465	475	N/A	INTRINSIC
HMG	577	647	1.5e-25	SMART
low complexity region	755	767	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166207
AA Change: R504P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: R504P

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166877
AA Change: R464P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: R464P

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169129
AA Change: R464P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: R464P

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000205405
AA Change: R505P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205980

Predicted Effect

probably damaging
Transcript: ENSMUST00000206034
AA Change: R463P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206369
AA Change: R505P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206775

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,126,313		probably null	Het
Acyp1	C	T	12: 85,278,905	V107I	probably null	Het
Aftph	T	C	11: 20,726,144		probably null	Het
Agtpbp1	A	T	13: 59,544,353		probably null	Het
Arhgap15	C	A	2: 44,116,677	P269T	probably damaging	Het
Arhgap30	T	C	1: 171,407,729	V557A	probably damaging	Het
Asb3	T	A	11: 31,081,493	M410K	probably benign	Het
B4galnt2	T	C	11: 95,868,634		probably null	Het
Birc3	A	G	9: 7,860,261		probably null	Het
Cav2	A	T	6: 17,286,951	N69Y	probably damaging	Het
Cc2d2b	G	A	19: 40,795,667	C826Y	probably benign	Het
Cenpf	T	A	1: 189,652,854	T2410S	probably benign	Het
Chchd1	A	G	14: 20,703,380	D24G	probably benign	Het
Cmip	G	A	8: 117,436,879	G450S	probably benign	Het
Col11a1	C	T	3: 114,212,450	Q534*	probably null	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Cox4i1	T	C	8: 120,673,230	I31T	possibly damaging	Het
Cstf3	G	T	2: 104,646,767	V168F	probably damaging	Het
Dapk1	T	C	13: 60,725,340	I352T	probably benign	Het
Ddx52	T	C	11: 83,955,302	V456A	probably damaging	Het
Dmxl2	A	T	9: 54,416,088	H1337Q	probably damaging	Het
Dnah7a	T	C	1: 53,636,062	T369A	probably benign	Het
Dppa1	T	A	11: 46,625,595	I8F	unknown	Het
Ebf1	G	T	11: 44,883,814	V213F	probably damaging	Het
Foxb2	C	A	19: 16,872,833	E270*	probably null	Het
Gclc	A	T	9: 77,788,245	R450W	probably damaging	Het
Gm13128	T	C	4: 144,332,978	W420R	probably benign	Het
Grin2d	T	C	7: 45,862,268	E251G	probably damaging	Het
Hal	A	T	10: 93,500,677	N423Y	probably damaging	Het
Krtap4-8	T	A	11: 99,780,091	I185F	unknown	Het
Lrp3	T	A	7: 35,211,437	Q61L	probably benign	Het
Met	A	C	6: 17,571,467	Q1296H	probably damaging	Het
Mphosph9	T	A	5: 124,297,699	N557I	possibly damaging	Het
Mrpl46	C	A	7: 78,782,981	W16C	probably benign	Het
Myh13	G	A	11: 67,350,419	R874Q	probably damaging	Het
Nelfb	G	A	2: 25,203,381	T453I	probably benign	Het
Nos2	A	G	11: 78,952,954	D909G	probably damaging	Het
Nr5a2	T	C	1: 136,882,344	E431G	possibly damaging	Het
Nsmce2	A	G	15: 59,591,724	D149G	probably benign	Het
Olfr203	T	C	16: 59,303,641	F164L	probably benign	Het
Olfr690	C	T	7: 105,330,027	R55H	probably benign	Het
Pcbp4	C	A	9: 106,460,648		probably null	Het
Peg10	A	G	6: 4,757,137		probably benign	Het
Pms2	C	T	5: 143,925,419	P154L	probably benign	Het
Pou6f2	A	C	13: 18,129,187	L112R	probably benign	Het
Prdm6	A	T	18: 53,465,046		probably benign	Het
Prob1	G	A	18: 35,655,154	R12W	probably damaging	Het
Rif1	T	A	2: 52,078,263		probably null	Het
Rpl9-ps6	A	G	19: 32,466,143	S137P	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Homo
Sec23ip	A	G	7: 128,752,849		silent	Het
Slc38a9	T	C	13: 112,690,180	C151R	probably benign	Het
Slc39a8	T	C	3: 135,849,180		probably null	Het
Slc6a18	C	A	13: 73,677,991		probably benign	Het
Snw1	T	C	12: 87,464,710	D57G	probably damaging	Het
Speg	T	C	1: 75,410,395		probably null	Het
Spire2	C	T	8: 123,356,846	R190C	probably damaging	Het
Stard9	A	C	2: 120,698,383	H1707P	possibly damaging	Het
Tenm3	G	T	8: 48,343,243	T237K	probably damaging	Het
Themis2	T	A	4: 132,796,262	E31V	possibly damaging	Het
Trim56	T	G	5: 137,114,521	Q47P	probably damaging	Het
Trim58	T	C	11: 58,651,264	I350T	probably benign	Het
Ttll7	C	T	3: 146,944,056	P639S	probably benign	Het
Ubxn6	A	G	17: 56,070,650		probably null	Het
Vmn2r114	A	T	17: 23,309,876	F417L	probably benign	Het
Vmn2r29	T	A	7: 7,231,422	M822L	probably benign	Het
Vps9d1	T	C	8: 123,254,007	D27G	probably damaging	Het
Wdr3	C	T	3: 100,138,724	R931Q	probably damaging	Het
Whamm	G	A	7: 81,578,302		probably null	Het
Zcchc24	T	C	14: 25,757,033	H142R	probably damaging	Het
Zfp292	T	C	4: 34,806,894	K2050R	probably damaging	Het

Other mutations in Sox6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Sox6	APN	7	115477206	missense	probably benign
IGL00957:Sox6	APN	7	115777092	missense	probably damaging	1.00
IGL01624:Sox6	APN	7	115476968	missense	probably damaging	1.00
IGL02057:Sox6	APN	7	115550075	missense	probably damaging	1.00
IGL02385:Sox6	APN	7	115550039	missense	possibly damaging	0.77
IGL02410:Sox6	APN	7	115486744	missense	probably damaging	1.00
IGL02736:Sox6	APN	7	115580640	missense	probably damaging	1.00
IGL02747:Sox6	APN	7	115489746	missense	probably damaging	1.00
IGL02792:Sox6	APN	7	115541649	missense	probably benign
PIT4480001:Sox6	UTSW	7	115597509	missense	probably benign	0.03
R0458:Sox6	UTSW	7	115489794	missense	probably damaging	1.00
R0689:Sox6	UTSW	7	115486551	missense	probably damaging	1.00
R0800:Sox6	UTSW	7	115579014	critical splice donor site	probably null
R1220:Sox6	UTSW	7	115662442	missense	probably damaging	1.00
R1474:Sox6	UTSW	7	115701691	splice site	probably benign
R1547:Sox6	UTSW	7	115701722	missense	possibly damaging	0.93
R1570:Sox6	UTSW	7	115777123	missense	probably damaging	1.00
R1674:Sox6	UTSW	7	115801419	missense	probably benign	0.00
R1704:Sox6	UTSW	7	115476948	missense	possibly damaging	0.92
R1754:Sox6	UTSW	7	115477055	missense	probably benign
R1833:Sox6	UTSW	7	115777093	missense	probably damaging	1.00
R1868:Sox6	UTSW	7	115659538	missense	possibly damaging	0.89
R1893:Sox6	UTSW	7	115544568	missense	probably benign	0.28
R2386:Sox6	UTSW	7	115597505	missense	probably damaging	1.00
R2431:Sox6	UTSW	7	115550007	splice site	probably null
R4303:Sox6	UTSW	7	115544469	critical splice donor site	probably null
R4319:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4320:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4321:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4323:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4335:Sox6	UTSW	7	115512724	missense	probably benign
R4567:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R4776:Sox6	UTSW	7	115541670	missense	probably damaging	1.00
R4838:Sox6	UTSW	7	115486662	missense	probably damaging	1.00
R4914:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R4915:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R5184:Sox6	UTSW	7	115777228	missense	probably damaging	1.00
R5372:Sox6	UTSW	7	115550151	nonsense	probably null
R5454:Sox6	UTSW	7	115701773	missense	possibly damaging	0.89
R5663:Sox6	UTSW	7	115550054	missense	probably benign
R5685:Sox6	UTSW	7	115579157	splice site	probably null
R5734:Sox6	UTSW	7	115541621	critical splice donor site	probably null
R6020:Sox6	UTSW	7	115486628	missense	probably damaging	1.00
R6211:Sox6	UTSW	7	115801462	missense	probably damaging	1.00
R6263:Sox6	UTSW	7	115477060	missense	probably damaging	1.00
R6549:Sox6	UTSW	7	115486692	missense	possibly damaging	0.79
R6576:Sox6	UTSW	7	115701702	missense	probably damaging	0.96
R6680:Sox6	UTSW	7	115476983	missense	possibly damaging	0.94
R6709:Sox6	UTSW	7	115701789	splice site	probably null
R6755:Sox6	UTSW	7	115662442	missense	probably damaging	0.99
R7233:Sox6	UTSW	7	115489809	missense	possibly damaging	0.80
R7423:Sox6	UTSW	7	115550023	missense	probably benign	0.30
R7455:Sox6	UTSW	7	115489669	missense	probably benign	0.02
R7522:Sox6	UTSW	7	115801578	missense	probably damaging	1.00
R7527:Sox6	UTSW	7	115777173	missense	probably benign	0.00
R7852:Sox6	UTSW	7	115801604	start codon destroyed	probably null	1.00
R7936:Sox6	UTSW	7	115544595	missense	probably benign
R8278:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R8335:Sox6	UTSW	7	115701714	missense	probably damaging	1.00
R8558:Sox6	UTSW	7	115541798	missense	probably benign	0.12
R8682:Sox6	UTSW	7	115476956	missense	probably damaging	1.00
R8693:Sox6	UTSW	7	115662397	missense	probably damaging	0.99
R8712:Sox6	UTSW	7	115597508	missense	probably benign	0.00
X0061:Sox6	UTSW	7	115477148	missense	probably benign	0.00
X0065:Sox6	UTSW	7	115550108	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTACAAGGTGGCCCTCAAGC -3'
(R):5'- AGAGAATACACTGTTACCCTGGG -3'

Sequencing Primer
(F):5'- AAGCCCAGATCTTTGGTAGC -3'
(R):5'- ATACACTGTTACCCTGGGGAATG -3'

Posted On

2018-08-01