Incidental Mutation 'R6747:Cmip'
ID 530591
Institutional Source Beutler Lab
Gene Symbol Cmip
Ensembl Gene ENSMUSG00000034390
Gene Name c-Maf inducing protein
Synonyms 5830471E12Rik, 4933407C03Rik
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6747 (G1)
Quality Score 155.008
Status Validated
Chromosome 8
Chromosomal Location 117983803-118186169 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118163618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 450 (G450S)
Ref Sequence ENSEMBL: ENSMUSP00000130264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095172] [ENSMUST00000166750]
AlphaFold Q9D486
Predicted Effect probably benign
Transcript: ENSMUST00000095172
AA Change: G362S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092795
Gene: ENSMUSG00000034390
AA Change: G362S

DomainStartEndE-ValueType
Blast:PH 13 70 5e-33 BLAST
low complexity region 71 79 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
SCOP:d1a9na_ 564 681 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166750
AA Change: G450S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130264
Gene: ENSMUSG00000034390
AA Change: G450S

DomainStartEndE-ValueType
PH 54 163 2.71e-1 SMART
low complexity region 394 407 N/A INTRINSIC
SCOP:d1a9na_ 652 769 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212884
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 121,919,962 (GRCm39) probably null Het
Acyp1 C T 12: 85,325,679 (GRCm39) V107I probably null Het
Aftph T C 11: 20,676,144 (GRCm39) probably null Het
Agtpbp1 A T 13: 59,692,167 (GRCm39) probably null Het
Arhgap15 C A 2: 44,006,689 (GRCm39) P269T probably damaging Het
Arhgap30 T C 1: 171,235,297 (GRCm39) V557A probably damaging Het
Asb3 T A 11: 31,031,493 (GRCm39) M410K probably benign Het
B4galnt2 T C 11: 95,759,460 (GRCm39) probably null Het
Birc2 A G 9: 7,860,262 (GRCm39) probably null Het
Cav2 A T 6: 17,286,950 (GRCm39) N69Y probably damaging Het
Cc2d2b G A 19: 40,784,111 (GRCm39) C826Y probably benign Het
Cenpf T A 1: 189,385,051 (GRCm39) T2410S probably benign Het
Chchd1 A G 14: 20,753,448 (GRCm39) D24G probably benign Het
Col11a1 C T 3: 114,006,099 (GRCm39) Q534* probably null Het
Col3a1 G T 1: 45,377,782 (GRCm39) probably benign Het
Cox4i1 T C 8: 121,399,969 (GRCm39) I31T possibly damaging Het
Cstf3 G T 2: 104,477,112 (GRCm39) V168F probably damaging Het
Dapk1 T C 13: 60,873,154 (GRCm39) I352T probably benign Het
Ddx52 T C 11: 83,846,128 (GRCm39) V456A probably damaging Het
Dmxl2 A T 9: 54,323,372 (GRCm39) H1337Q probably damaging Het
Dnah7a T C 1: 53,675,221 (GRCm39) T369A probably benign Het
Dppa1 T A 11: 46,516,422 (GRCm39) I8F unknown Het
Ebf1 G T 11: 44,774,641 (GRCm39) V213F probably damaging Het
Foxb2 C A 19: 16,850,197 (GRCm39) E270* probably null Het
Gclc A T 9: 77,695,527 (GRCm39) R450W probably damaging Het
Grin2d T C 7: 45,511,692 (GRCm39) E251G probably damaging Het
Hal A T 10: 93,336,539 (GRCm39) N423Y probably damaging Het
Krtap4-8 T A 11: 99,670,917 (GRCm39) I185F unknown Het
Lrp3 T A 7: 34,910,862 (GRCm39) Q61L probably benign Het
Met A C 6: 17,571,466 (GRCm39) Q1296H probably damaging Het
Mphosph9 T A 5: 124,435,762 (GRCm39) N557I possibly damaging Het
Mrpl46 C A 7: 78,432,729 (GRCm39) W16C probably benign Het
Myh13 G A 11: 67,241,245 (GRCm39) R874Q probably damaging Het
Nelfb G A 2: 25,093,393 (GRCm39) T453I probably benign Het
Nos2 A G 11: 78,843,780 (GRCm39) D909G probably damaging Het
Nr5a2 T C 1: 136,810,082 (GRCm39) E431G possibly damaging Het
Nsmce2 A G 15: 59,463,573 (GRCm39) D149G probably benign Het
Or52b1 C T 7: 104,979,234 (GRCm39) R55H probably benign Het
Or5ac21 T C 16: 59,124,004 (GRCm39) F164L probably benign Het
Pcbp4 C A 9: 106,337,847 (GRCm39) probably null Het
Peg10 A G 6: 4,757,137 (GRCm39) probably benign Het
Pms2 C T 5: 143,862,237 (GRCm39) P154L probably benign Het
Pou6f2 A C 13: 18,303,772 (GRCm39) L112R probably benign Het
Pramel30 T C 4: 144,059,548 (GRCm39) W420R probably benign Het
Prdm6 A T 18: 53,598,118 (GRCm39) probably benign Het
Prob1 G A 18: 35,788,207 (GRCm39) R12W probably damaging Het
Rif1 T A 2: 51,968,275 (GRCm39) probably null Het
Rpl9-ps6 A G 19: 32,443,543 (GRCm39) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sec23ip A G 7: 128,354,573 (GRCm39) silent Het
Slc38a9 T C 13: 112,826,714 (GRCm39) C151R probably benign Het
Slc39a8 T C 3: 135,554,941 (GRCm39) probably null Het
Slc6a18 C A 13: 73,826,110 (GRCm39) probably benign Het
Snw1 T C 12: 87,511,480 (GRCm39) D57G probably damaging Het
Sox6 C G 7: 115,140,966 (GRCm39) R505P probably damaging Het
Speg T C 1: 75,387,039 (GRCm39) probably null Het
Spire2 C T 8: 124,083,585 (GRCm39) R190C probably damaging Het
Stard9 A C 2: 120,528,864 (GRCm39) H1707P possibly damaging Het
Tenm3 G T 8: 48,796,278 (GRCm39) T237K probably damaging Het
Themis2 T A 4: 132,523,573 (GRCm39) E31V possibly damaging Het
Trim56 T G 5: 137,143,375 (GRCm39) Q47P probably damaging Het
Trim58 T C 11: 58,542,090 (GRCm39) I350T probably benign Het
Ttll7 C T 3: 146,649,811 (GRCm39) P639S probably benign Het
Ubxn6 A G 17: 56,377,650 (GRCm39) probably null Het
Vmn2r114 A T 17: 23,528,850 (GRCm39) F417L probably benign Het
Vmn2r29 T A 7: 7,234,421 (GRCm39) M822L probably benign Het
Vps9d1 T C 8: 123,980,746 (GRCm39) D27G probably damaging Het
Wdr3 C T 3: 100,046,040 (GRCm39) R931Q probably damaging Het
Whamm G A 7: 81,228,050 (GRCm39) probably null Het
Zcchc24 T C 14: 25,757,457 (GRCm39) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm39) K2050R probably damaging Het
Other mutations in Cmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Cmip APN 8 118,172,067 (GRCm39) missense probably benign 0.29
IGL02126:Cmip APN 8 118,175,770 (GRCm39) missense probably damaging 0.99
IGL02205:Cmip APN 8 118,181,714 (GRCm39) missense probably damaging 1.00
IGL02352:Cmip APN 8 118,137,994 (GRCm39) splice site probably benign
IGL02359:Cmip APN 8 118,137,994 (GRCm39) splice site probably benign
IGL02558:Cmip APN 8 118,175,827 (GRCm39) missense probably damaging 0.99
R0070:Cmip UTSW 8 118,153,293 (GRCm39) missense probably damaging 0.99
R0335:Cmip UTSW 8 118,172,105 (GRCm39) missense probably damaging 0.99
R1225:Cmip UTSW 8 118,172,110 (GRCm39) missense probably damaging 0.98
R1561:Cmip UTSW 8 118,180,589 (GRCm39) missense probably benign 0.41
R2508:Cmip UTSW 8 118,163,432 (GRCm39) missense probably benign
R2885:Cmip UTSW 8 118,111,704 (GRCm39) missense probably benign 0.01
R3415:Cmip UTSW 8 118,076,116 (GRCm39) critical splice donor site probably null
R4024:Cmip UTSW 8 118,174,155 (GRCm39) missense possibly damaging 0.79
R4168:Cmip UTSW 8 118,183,656 (GRCm39) missense probably damaging 1.00
R4169:Cmip UTSW 8 118,183,656 (GRCm39) missense probably damaging 1.00
R4632:Cmip UTSW 8 118,174,150 (GRCm39) missense possibly damaging 0.88
R4706:Cmip UTSW 8 118,103,893 (GRCm39) missense probably damaging 0.99
R4924:Cmip UTSW 8 117,983,994 (GRCm39) missense probably benign 0.00
R5380:Cmip UTSW 8 118,149,629 (GRCm39) missense probably damaging 0.99
R5927:Cmip UTSW 8 117,984,048 (GRCm39) missense possibly damaging 0.85
R6212:Cmip UTSW 8 118,103,895 (GRCm39) missense probably damaging 1.00
R6310:Cmip UTSW 8 118,156,549 (GRCm39) missense possibly damaging 0.63
R6881:Cmip UTSW 8 118,163,334 (GRCm39) missense possibly damaging 0.77
R6968:Cmip UTSW 8 118,103,895 (GRCm39) missense probably damaging 1.00
R7003:Cmip UTSW 8 118,111,727 (GRCm39) missense probably benign 0.13
R7400:Cmip UTSW 8 117,984,144 (GRCm39) splice site probably null
R7583:Cmip UTSW 8 118,181,691 (GRCm39) missense probably damaging 0.96
R8367:Cmip UTSW 8 118,163,610 (GRCm39) missense probably benign 0.05
R8720:Cmip UTSW 8 118,138,010 (GRCm39) missense probably damaging 1.00
R8807:Cmip UTSW 8 118,138,094 (GRCm39) missense probably benign 0.23
R8873:Cmip UTSW 8 118,103,929 (GRCm39) missense probably damaging 0.96
R8902:Cmip UTSW 8 118,103,925 (GRCm39) missense probably damaging 0.98
R8959:Cmip UTSW 8 118,138,054 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAAGCCCACCTTACCTCTG -3'
(R):5'- GCATGCGCATATACCTACCC -3'

Sequencing Primer
(F):5'- TCAGGAAGCCACATTGTCTG -3'
(R):5'- CCATAGGACTCAGGAGCATGC -3'
Posted On 2018-08-01