Incidental Mutation 'R6747:Asb3'
ID530599
Institutional Source Beutler Lab
Gene Symbol Asb3
Ensembl Gene ENSMUSG00000020305
Gene Nameankyrin repeat and SOCS box-containing 3
Synonyms2400011J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30885416-31102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31081493 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 410 (M410K)
Ref Sequence ENSEMBL: ENSMUSP00000144900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000117883] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000020551
AA Change: M371K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305
AA Change: M371K

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117883
AA Change: M371K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305
AA Change: M371K

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203878
AA Change: M410K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305
AA Change: M410K

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Asb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:Asb3 APN 11 31101067 missense probably damaging 1.00
IGL02932:Asb3 APN 11 31029067 critical splice donor site probably null
Kickbox UTSW 11 30998326 missense probably damaging 1.00
low_blow UTSW 11 30998348 nonsense probably null
Octagon UTSW 11 30998321 missense probably benign 0.34
penalty UTSW 11 31081357 splice site probably null
sixpack UTSW 11 31085143 missense probably benign
R0573:Asb3 UTSW 11 31061406 missense probably damaging 0.99
R1395:Asb3 UTSW 11 31101032 splice site probably benign
R1545:Asb3 UTSW 11 31056217 missense probably benign 0.00
R2108:Asb3 UTSW 11 31081355 splice site probably null
R2364:Asb3 UTSW 11 31101192 missense probably benign 0.01
R4527:Asb3 UTSW 11 31058933 missense probably benign 0.30
R5019:Asb3 UTSW 11 31081415 missense possibly damaging 0.95
R5176:Asb3 UTSW 11 31081357 splice site probably null
R5344:Asb3 UTSW 11 31101114 missense probably benign 0.01
R5734:Asb3 UTSW 11 31029021 missense probably damaging 1.00
R6251:Asb3 UTSW 11 31055559 missense probably damaging 1.00
R6265:Asb3 UTSW 11 31085143 missense probably benign
R6827:Asb3 UTSW 11 31101211 missense probably benign 0.00
R6928:Asb3 UTSW 11 30998326 missense probably damaging 1.00
R7048:Asb3 UTSW 11 31101121 missense probably damaging 1.00
R7087:Asb3 UTSW 11 30998321 missense probably benign 0.34
R7135:Asb3 UTSW 11 30998501 nonsense probably null
R7165:Asb3 UTSW 11 31029029 missense probably damaging 0.99
R7200:Asb3 UTSW 11 30998348 nonsense probably null
R7265:Asb3 UTSW 11 30998495 missense probably benign 0.02
R7509:Asb3 UTSW 11 30998507 missense probably benign 0.12
R7674:Asb3 UTSW 11 31081435 missense possibly damaging 0.92
RF016:Asb3 UTSW 11 31061407 missense possibly damaging 0.95
X0024:Asb3 UTSW 11 31058950 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCATGTAAAAGCCATTGGTTATACC -3'
(R):5'- TCACGCAATGCAGATATGGTG -3'

Sequencing Primer
(F):5'- ACCAAGTGCTATTTTCATTTCCAG -3'
(R):5'- TATGGTGGTCAGTACACACAC -3'
Posted On2018-08-01