Mutagenetix > Incidental Mutation

Incidental Mutation 'R6747:Dapk1'

530610

Institutional Source

Beutler Lab

Gene Symbol

Dapk1

Ensembl Gene

ENSMUSG00000021559

Gene Name

death associated protein kinase 1

Synonyms

DAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60601947-60763191 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60725340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 352 (I352T)

Ref Sequence

ENSEMBL: ENSMUSP00000153607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]

AlphaFold

Q80YE7

Predicted Effect

probably benign
Transcript: ENSMUST00000044083
AA Change: I352T

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: I352T

Domain	Start	End	E-Value	Type
S_TKc	13	275	6.35e-99	SMART
low complexity region	295	306	N/A	INTRINSIC
ANK	378	407	5.09e-2	SMART
ANK	411	440	6.61e-1	SMART
ANK	444	473	7.64e-6	SMART
ANK	477	506	2.13e-4	SMART
ANK	510	539	1.31e-4	SMART
ANK	543	572	7.83e-3	SMART
ANK	576	605	8.52e-4	SMART
ANK	609	638	1.85e-4	SMART
ANK	642	671	7.29e2	SMART
low complexity region	711	725	N/A	INTRINSIC
DEATH	1299	1396	2.65e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077453
AA Change: I352T

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: I352T

Domain	Start	End	E-Value	Type
S_TKc	13	275	6.35e-99	SMART
low complexity region	295	306	N/A	INTRINSIC
ANK	378	407	5.09e-2	SMART
ANK	411	440	6.61e-1	SMART
ANK	444	473	7.64e-6	SMART
ANK	477	506	2.13e-4	SMART
ANK	510	539	1.31e-4	SMART
ANK	543	572	7.83e-3	SMART
ANK	576	605	8.52e-4	SMART
ANK	609	638	1.85e-4	SMART
ANK	642	671	7.29e2	SMART
low complexity region	711	725	N/A	INTRINSIC
Pfam:COR	984	1176	4.2e-10	PFAM
DEATH	1299	1396	2.65e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224340

Predicted Effect

probably benign
Transcript: ENSMUST00000224789

Predicted Effect

probably benign
Transcript: ENSMUST00000226059
AA Change: I352T

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.2912

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,126,313		probably null	Het
Acyp1	C	T	12: 85,278,905	V107I	probably null	Het
Aftph	T	C	11: 20,726,144		probably null	Het
Agtpbp1	A	T	13: 59,544,353		probably null	Het
Arhgap15	C	A	2: 44,116,677	P269T	probably damaging	Het
Arhgap30	T	C	1: 171,407,729	V557A	probably damaging	Het
Asb3	T	A	11: 31,081,493	M410K	probably benign	Het
B4galnt2	T	C	11: 95,868,634		probably null	Het
Birc3	A	G	9: 7,860,261		probably null	Het
Cav2	A	T	6: 17,286,951	N69Y	probably damaging	Het
Cc2d2b	G	A	19: 40,795,667	C826Y	probably benign	Het
Cenpf	T	A	1: 189,652,854	T2410S	probably benign	Het
Chchd1	A	G	14: 20,703,380	D24G	probably benign	Het
Cmip	G	A	8: 117,436,879	G450S	probably benign	Het
Col11a1	C	T	3: 114,212,450	Q534*	probably null	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Cox4i1	T	C	8: 120,673,230	I31T	possibly damaging	Het
Cstf3	G	T	2: 104,646,767	V168F	probably damaging	Het
Ddx52	T	C	11: 83,955,302	V456A	probably damaging	Het
Dmxl2	A	T	9: 54,416,088	H1337Q	probably damaging	Het
Dnah7a	T	C	1: 53,636,062	T369A	probably benign	Het
Dppa1	T	A	11: 46,625,595	I8F	unknown	Het
Ebf1	G	T	11: 44,883,814	V213F	probably damaging	Het
Foxb2	C	A	19: 16,872,833	E270*	probably null	Het
Gclc	A	T	9: 77,788,245	R450W	probably damaging	Het
Gm13128	T	C	4: 144,332,978	W420R	probably benign	Het
Grin2d	T	C	7: 45,862,268	E251G	probably damaging	Het
Hal	A	T	10: 93,500,677	N423Y	probably damaging	Het
Krtap4-8	T	A	11: 99,780,091	I185F	unknown	Het
Lrp3	T	A	7: 35,211,437	Q61L	probably benign	Het
Met	A	C	6: 17,571,467	Q1296H	probably damaging	Het
Mphosph9	T	A	5: 124,297,699	N557I	possibly damaging	Het
Mrpl46	C	A	7: 78,782,981	W16C	probably benign	Het
Myh13	G	A	11: 67,350,419	R874Q	probably damaging	Het
Nelfb	G	A	2: 25,203,381	T453I	probably benign	Het
Nos2	A	G	11: 78,952,954	D909G	probably damaging	Het
Nr5a2	T	C	1: 136,882,344	E431G	possibly damaging	Het
Nsmce2	A	G	15: 59,591,724	D149G	probably benign	Het
Olfr203	T	C	16: 59,303,641	F164L	probably benign	Het
Olfr690	C	T	7: 105,330,027	R55H	probably benign	Het
Pcbp4	C	A	9: 106,460,648		probably null	Het
Peg10	A	G	6: 4,757,137		probably benign	Het
Pms2	C	T	5: 143,925,419	P154L	probably benign	Het
Pou6f2	A	C	13: 18,129,187	L112R	probably benign	Het
Prdm6	A	T	18: 53,465,046		probably benign	Het
Prob1	G	A	18: 35,655,154	R12W	probably damaging	Het
Rif1	T	A	2: 52,078,263		probably null	Het
Rpl9-ps6	A	G	19: 32,466,143	S137P	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Homo
Sec23ip	A	G	7: 128,752,849		silent	Het
Slc38a9	T	C	13: 112,690,180	C151R	probably benign	Het
Slc39a8	T	C	3: 135,849,180		probably null	Het
Slc6a18	C	A	13: 73,677,991		probably benign	Het
Snw1	T	C	12: 87,464,710	D57G	probably damaging	Het
Sox6	C	G	7: 115,541,731	R505P	probably damaging	Het
Speg	T	C	1: 75,410,395		probably null	Het
Spire2	C	T	8: 123,356,846	R190C	probably damaging	Het
Stard9	A	C	2: 120,698,383	H1707P	possibly damaging	Het
Tenm3	G	T	8: 48,343,243	T237K	probably damaging	Het
Themis2	T	A	4: 132,796,262	E31V	possibly damaging	Het
Trim56	T	G	5: 137,114,521	Q47P	probably damaging	Het
Trim58	T	C	11: 58,651,264	I350T	probably benign	Het
Ttll7	C	T	3: 146,944,056	P639S	probably benign	Het
Ubxn6	A	G	17: 56,070,650		probably null	Het
Vmn2r114	A	T	17: 23,309,876	F417L	probably benign	Het
Vmn2r29	T	A	7: 7,231,422	M822L	probably benign	Het
Vps9d1	T	C	8: 123,254,007	D27G	probably damaging	Het
Wdr3	C	T	3: 100,138,724	R931Q	probably damaging	Het
Whamm	G	A	7: 81,578,302		probably null	Het
Zcchc24	T	C	14: 25,757,033	H142R	probably damaging	Het
Zfp292	T	C	4: 34,806,894	K2050R	probably damaging	Het

Other mutations in Dapk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Dapk1	APN	13	60761040	missense	probably benign	0.23
IGL00500:Dapk1	APN	13	60760804	missense	probably damaging	0.96
IGL00801:Dapk1	APN	13	60761248	missense	probably benign	0.00
IGL00903:Dapk1	APN	13	60761397	missense	probably damaging	0.99
IGL01468:Dapk1	APN	13	60760798	missense	probably benign
IGL01535:Dapk1	APN	13	60731031	splice site	probably benign
IGL01755:Dapk1	APN	13	60761175	missense	probably damaging	0.97
IGL01755:Dapk1	APN	13	60761176	missense	possibly damaging	0.63
IGL01862:Dapk1	APN	13	60726610	missense	probably benign	0.39
IGL01985:Dapk1	APN	13	60736260	missense	probably damaging	1.00
IGL02124:Dapk1	APN	13	60730882	missense	probably benign
IGL02376:Dapk1	APN	13	60696394	missense	probably benign	0.00
IGL02449:Dapk1	APN	13	60719770	splice site	probably benign
IGL02490:Dapk1	APN	13	60749334	missense	probably damaging	1.00
IGL02503:Dapk1	APN	13	60761807	nonsense	probably null
IGL02516:Dapk1	APN	13	60696347	missense	probably damaging	1.00
IGL02544:Dapk1	APN	13	60751217	missense	probably benign
IGL02604:Dapk1	APN	13	60748320	missense	probably benign
IGL03035:Dapk1	APN	13	60716773	missense	probably damaging	0.99
H8562:Dapk1	UTSW	13	60761312	missense	probably damaging	0.98
P0026:Dapk1	UTSW	13	60718149	splice site	probably benign
R0116:Dapk1	UTSW	13	60761100	missense	probably benign
R0165:Dapk1	UTSW	13	60761593	missense	probably benign	0.39
R0357:Dapk1	UTSW	13	60729558	nonsense	probably null
R0446:Dapk1	UTSW	13	60725287	splice site	probably null
R0502:Dapk1	UTSW	13	60730848	splice site	probably null
R0503:Dapk1	UTSW	13	60730848	splice site	probably null
R0597:Dapk1	UTSW	13	60761384	missense	probably benign	0.40
R0614:Dapk1	UTSW	13	60718132	missense	probably damaging	1.00
R0751:Dapk1	UTSW	13	60696298	missense	probably damaging	1.00
R0930:Dapk1	UTSW	13	60757448	missense	probably benign	0.14
R1023:Dapk1	UTSW	13	60730985	missense	probably damaging	1.00
R1033:Dapk1	UTSW	13	60721865	critical splice donor site	probably null
R1101:Dapk1	UTSW	13	60716785	missense	probably damaging	1.00
R1184:Dapk1	UTSW	13	60696298	missense	probably damaging	1.00
R1430:Dapk1	UTSW	13	60754143	missense	probably benign	0.28
R1630:Dapk1	UTSW	13	60729531	missense	probably damaging	0.99
R1681:Dapk1	UTSW	13	60718464	critical splice donor site	probably null
R1799:Dapk1	UTSW	13	60719654	missense	probably damaging	1.00
R2012:Dapk1	UTSW	13	60721857	missense	probably damaging	1.00
R2068:Dapk1	UTSW	13	60751208	missense	probably damaging	1.00
R2131:Dapk1	UTSW	13	60729531	missense	possibly damaging	0.91
R2131:Dapk1	UTSW	13	60761667	missense	possibly damaging	0.80
R2154:Dapk1	UTSW	13	60729503	missense	probably benign	0.36
R2288:Dapk1	UTSW	13	60761749	missense	probably damaging	1.00
R2312:Dapk1	UTSW	13	60757353	missense	probably damaging	0.99
R2362:Dapk1	UTSW	13	60730931	missense	probably damaging	0.98
R2400:Dapk1	UTSW	13	60752216	missense	probably benign	0.34
R2909:Dapk1	UTSW	13	60716817	critical splice donor site	probably null
R2926:Dapk1	UTSW	13	60719750	missense	possibly damaging	0.58
R3741:Dapk1	UTSW	13	60748200	missense	probably benign	0.09
R3810:Dapk1	UTSW	13	60760689	missense	probably damaging	0.98
R4374:Dapk1	UTSW	13	60719684	missense	probably benign	0.01
R4375:Dapk1	UTSW	13	60761589	missense	probably benign
R4377:Dapk1	UTSW	13	60719684	missense	probably benign	0.01
R4490:Dapk1	UTSW	13	60718128	missense	probably benign	0.26
R4576:Dapk1	UTSW	13	60721822	missense	probably benign	0.13
R4599:Dapk1	UTSW	13	60718047	missense	probably benign	0.22
R4682:Dapk1	UTSW	13	60751147	missense	probably benign	0.41
R4717:Dapk1	UTSW	13	60726662	critical splice donor site	probably null
R4775:Dapk1	UTSW	13	60749342	missense	probably benign	0.02
R4790:Dapk1	UTSW	13	60723105	frame shift	probably null
R4897:Dapk1	UTSW	13	60761786	missense	probably benign	0.01
R4931:Dapk1	UTSW	13	60760960	missense	probably benign	0.04
R5113:Dapk1	UTSW	13	60721778	missense	probably benign	0.01
R5503:Dapk1	UTSW	13	60725312	missense	probably benign	0.15
R5948:Dapk1	UTSW	13	60729395	missense	probably damaging	0.97
R6012:Dapk1	UTSW	13	60761662	missense	probably benign	0.00
R6035:Dapk1	UTSW	13	60761199	missense	possibly damaging	0.46
R6035:Dapk1	UTSW	13	60761199	missense	possibly damaging	0.46
R6268:Dapk1	UTSW	13	60761766	missense	possibly damaging	0.91
R6330:Dapk1	UTSW	13	60761326	missense	probably benign	0.01
R6331:Dapk1	UTSW	13	60729442	nonsense	probably null
R6553:Dapk1	UTSW	13	60761161	missense	probably damaging	0.99
R6598:Dapk1	UTSW	13	60761347	missense	probably benign	0.03
R6602:Dapk1	UTSW	13	60749204	missense	probably benign	0.20
R6640:Dapk1	UTSW	13	60716814	missense	probably damaging	0.99
R6684:Dapk1	UTSW	13	60760894	missense	probably damaging	1.00
R6799:Dapk1	UTSW	13	60752235	missense	probably benign
R6809:Dapk1	UTSW	13	60751289	missense	probably benign	0.00
R6915:Dapk1	UTSW	13	60696442	missense	probably damaging	1.00
R6949:Dapk1	UTSW	13	60736324	missense	probably benign	0.11
R6979:Dapk1	UTSW	13	60748281	missense	probably damaging	1.00
R7161:Dapk1	UTSW	13	60696395	missense	possibly damaging	0.89
R7171:Dapk1	UTSW	13	60761785	missense	probably damaging	0.97
R7199:Dapk1	UTSW	13	60754210	missense	probably benign	0.02
R7203:Dapk1	UTSW	13	60696335	missense	possibly damaging	0.90
R7404:Dapk1	UTSW	13	60719641	missense	probably benign	0.00
R7448:Dapk1	UTSW	13	60751176	missense	probably damaging	1.00
R7480:Dapk1	UTSW	13	60757497	missense	probably benign	0.18
R7532:Dapk1	UTSW	13	60730886	missense	probably damaging	1.00
R7574:Dapk1	UTSW	13	60761173	missense	probably damaging	1.00
R7711:Dapk1	UTSW	13	60761551	missense	probably damaging	1.00
R7753:Dapk1	UTSW	13	60751193	missense	possibly damaging	0.58
R7804:Dapk1	UTSW	13	60725339	missense	probably benign	0.41
R7822:Dapk1	UTSW	13	60725901	missense	probably benign	0.05
R7973:Dapk1	UTSW	13	60761563	missense	probably damaging	1.00
R8103:Dapk1	UTSW	13	60749195	missense	probably damaging	0.98
R8121:Dapk1	UTSW	13	60761398	missense	probably damaging	0.99
R8245:Dapk1	UTSW	13	60730896	missense	probably benign
R8401:Dapk1	UTSW	13	60723090	missense	probably benign	0.01
R8419:Dapk1	UTSW	13	60740097	missense	probably benign	0.00
R8926:Dapk1	UTSW	13	60760920	missense	probably damaging	0.98
R9063:Dapk1	UTSW	13	60718450	missense	probably benign	0.06
R9131:Dapk1	UTSW	13	60761394	missense	probably damaging	1.00
R9176:Dapk1	UTSW	13	60718448	missense	probably damaging	1.00
R9301:Dapk1	UTSW	13	60718311	missense	possibly damaging	0.92
R9407:Dapk1	UTSW	13	60751177	nonsense	probably null
R9491:Dapk1	UTSW	13	60729555	missense	probably benign	0.44
R9510:Dapk1	UTSW	13	60762389	missense	unknown
Z1176:Dapk1	UTSW	13	60760804	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCATGAAAGGGTACAGGTTCAC -3'
(R):5'- ACCTTAAGCAGAAAGGCCTTTC -3'

Sequencing Primer
(F):5'- AGGGTACAGGTTCACCTCCAAG -3'
(R):5'- AGGCCTTTCCCACAGAATG -3'

Posted On

2018-08-01