Incidental Mutation 'R6747:Prob1'
ID 530619
Institutional Source Beutler Lab
Gene Symbol Prob1
Ensembl Gene ENSMUSG00000073600
Gene Name proline rich basic protein 1
Synonyms LOC381148, Gm1614
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R6747 (G1)
Quality Score 162.009
Status Validated
Chromosome 18
Chromosomal Location 35783400-35788274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35788207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 12 (R12W)
Ref Sequence ENSEMBL: ENSMUSP00000095224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025209] [ENSMUST00000096573] [ENSMUST00000097619] [ENSMUST00000190196]
AlphaFold A0A087WR45
Predicted Effect probably benign
Transcript: ENSMUST00000025209
SMART Domains Protein: ENSMUSP00000025209
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 10 191 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096573
SMART Domains Protein: ENSMUSP00000094324
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 49 169 1.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097619
AA Change: R12W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095224
Gene: ENSMUSG00000073600
AA Change: R12W

DomainStartEndE-ValueType
low complexity region 78 102 N/A INTRINSIC
low complexity region 142 155 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 536 553 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
Pfam:DUF4585 862 931 4.6e-27 PFAM
low complexity region 989 1002 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186951
Predicted Effect unknown
Transcript: ENSMUST00000190196
AA Change: R16W
SMART Domains Protein: ENSMUSP00000140465
Gene: ENSMUSG00000073600
AA Change: R16W

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
low complexity region 381 400 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 833 852 N/A INTRINSIC
Pfam:DUF4585 864 936 7.5e-27 PFAM
low complexity region 993 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 121,919,962 (GRCm39) probably null Het
Acyp1 C T 12: 85,325,679 (GRCm39) V107I probably null Het
Aftph T C 11: 20,676,144 (GRCm39) probably null Het
Agtpbp1 A T 13: 59,692,167 (GRCm39) probably null Het
Arhgap15 C A 2: 44,006,689 (GRCm39) P269T probably damaging Het
Arhgap30 T C 1: 171,235,297 (GRCm39) V557A probably damaging Het
Asb3 T A 11: 31,031,493 (GRCm39) M410K probably benign Het
B4galnt2 T C 11: 95,759,460 (GRCm39) probably null Het
Birc2 A G 9: 7,860,262 (GRCm39) probably null Het
Cav2 A T 6: 17,286,950 (GRCm39) N69Y probably damaging Het
Cc2d2b G A 19: 40,784,111 (GRCm39) C826Y probably benign Het
Cenpf T A 1: 189,385,051 (GRCm39) T2410S probably benign Het
Chchd1 A G 14: 20,753,448 (GRCm39) D24G probably benign Het
Cmip G A 8: 118,163,618 (GRCm39) G450S probably benign Het
Col11a1 C T 3: 114,006,099 (GRCm39) Q534* probably null Het
Col3a1 G T 1: 45,377,782 (GRCm39) probably benign Het
Cox4i1 T C 8: 121,399,969 (GRCm39) I31T possibly damaging Het
Cstf3 G T 2: 104,477,112 (GRCm39) V168F probably damaging Het
Dapk1 T C 13: 60,873,154 (GRCm39) I352T probably benign Het
Ddx52 T C 11: 83,846,128 (GRCm39) V456A probably damaging Het
Dmxl2 A T 9: 54,323,372 (GRCm39) H1337Q probably damaging Het
Dnah7a T C 1: 53,675,221 (GRCm39) T369A probably benign Het
Dppa1 T A 11: 46,516,422 (GRCm39) I8F unknown Het
Ebf1 G T 11: 44,774,641 (GRCm39) V213F probably damaging Het
Foxb2 C A 19: 16,850,197 (GRCm39) E270* probably null Het
Gclc A T 9: 77,695,527 (GRCm39) R450W probably damaging Het
Grin2d T C 7: 45,511,692 (GRCm39) E251G probably damaging Het
Hal A T 10: 93,336,539 (GRCm39) N423Y probably damaging Het
Krtap4-8 T A 11: 99,670,917 (GRCm39) I185F unknown Het
Lrp3 T A 7: 34,910,862 (GRCm39) Q61L probably benign Het
Met A C 6: 17,571,466 (GRCm39) Q1296H probably damaging Het
Mphosph9 T A 5: 124,435,762 (GRCm39) N557I possibly damaging Het
Mrpl46 C A 7: 78,432,729 (GRCm39) W16C probably benign Het
Myh13 G A 11: 67,241,245 (GRCm39) R874Q probably damaging Het
Nelfb G A 2: 25,093,393 (GRCm39) T453I probably benign Het
Nos2 A G 11: 78,843,780 (GRCm39) D909G probably damaging Het
Nr5a2 T C 1: 136,810,082 (GRCm39) E431G possibly damaging Het
Nsmce2 A G 15: 59,463,573 (GRCm39) D149G probably benign Het
Or52b1 C T 7: 104,979,234 (GRCm39) R55H probably benign Het
Or5ac21 T C 16: 59,124,004 (GRCm39) F164L probably benign Het
Pcbp4 C A 9: 106,337,847 (GRCm39) probably null Het
Peg10 A G 6: 4,757,137 (GRCm39) probably benign Het
Pms2 C T 5: 143,862,237 (GRCm39) P154L probably benign Het
Pou6f2 A C 13: 18,303,772 (GRCm39) L112R probably benign Het
Pramel30 T C 4: 144,059,548 (GRCm39) W420R probably benign Het
Prdm6 A T 18: 53,598,118 (GRCm39) probably benign Het
Rif1 T A 2: 51,968,275 (GRCm39) probably null Het
Rpl9-ps6 A G 19: 32,443,543 (GRCm39) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sec23ip A G 7: 128,354,573 (GRCm39) silent Het
Slc38a9 T C 13: 112,826,714 (GRCm39) C151R probably benign Het
Slc39a8 T C 3: 135,554,941 (GRCm39) probably null Het
Slc6a18 C A 13: 73,826,110 (GRCm39) probably benign Het
Snw1 T C 12: 87,511,480 (GRCm39) D57G probably damaging Het
Sox6 C G 7: 115,140,966 (GRCm39) R505P probably damaging Het
Speg T C 1: 75,387,039 (GRCm39) probably null Het
Spire2 C T 8: 124,083,585 (GRCm39) R190C probably damaging Het
Stard9 A C 2: 120,528,864 (GRCm39) H1707P possibly damaging Het
Tenm3 G T 8: 48,796,278 (GRCm39) T237K probably damaging Het
Themis2 T A 4: 132,523,573 (GRCm39) E31V possibly damaging Het
Trim56 T G 5: 137,143,375 (GRCm39) Q47P probably damaging Het
Trim58 T C 11: 58,542,090 (GRCm39) I350T probably benign Het
Ttll7 C T 3: 146,649,811 (GRCm39) P639S probably benign Het
Ubxn6 A G 17: 56,377,650 (GRCm39) probably null Het
Vmn2r114 A T 17: 23,528,850 (GRCm39) F417L probably benign Het
Vmn2r29 T A 7: 7,234,421 (GRCm39) M822L probably benign Het
Vps9d1 T C 8: 123,980,746 (GRCm39) D27G probably damaging Het
Wdr3 C T 3: 100,046,040 (GRCm39) R931Q probably damaging Het
Whamm G A 7: 81,228,050 (GRCm39) probably null Het
Zcchc24 T C 14: 25,757,457 (GRCm39) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm39) K2050R probably damaging Het
Other mutations in Prob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Prob1 APN 18 35,786,386 (GRCm39) missense possibly damaging 0.91
IGL02352:Prob1 APN 18 35,785,893 (GRCm39) missense possibly damaging 0.53
IGL02359:Prob1 APN 18 35,785,893 (GRCm39) missense possibly damaging 0.53
IGL02823:Prob1 APN 18 35,785,800 (GRCm39) missense possibly damaging 0.86
IGL03003:Prob1 APN 18 35,786,428 (GRCm39) missense possibly damaging 0.73
IGL03390:Prob1 APN 18 35,787,192 (GRCm39) missense probably benign 0.03
R0257:Prob1 UTSW 18 35,786,092 (GRCm39) missense possibly damaging 0.53
R0421:Prob1 UTSW 18 35,786,083 (GRCm39) missense possibly damaging 0.70
R0457:Prob1 UTSW 18 35,785,539 (GRCm39) missense probably damaging 0.98
R0485:Prob1 UTSW 18 35,786,878 (GRCm39) missense possibly damaging 0.53
R0575:Prob1 UTSW 18 35,787,774 (GRCm39) missense possibly damaging 0.85
R1056:Prob1 UTSW 18 35,786,663 (GRCm39) missense probably benign
R1147:Prob1 UTSW 18 35,787,859 (GRCm39) nonsense probably null
R1334:Prob1 UTSW 18 35,786,305 (GRCm39) missense possibly damaging 0.53
R1727:Prob1 UTSW 18 35,787,364 (GRCm39) missense possibly damaging 0.73
R1753:Prob1 UTSW 18 35,786,305 (GRCm39) missense possibly damaging 0.53
R1826:Prob1 UTSW 18 35,786,628 (GRCm39) missense possibly damaging 0.72
R1895:Prob1 UTSW 18 35,785,942 (GRCm39) missense possibly damaging 0.53
R1937:Prob1 UTSW 18 35,787,279 (GRCm39) missense possibly damaging 0.53
R2170:Prob1 UTSW 18 35,787,790 (GRCm39) missense probably benign 0.18
R3435:Prob1 UTSW 18 35,787,294 (GRCm39) missense possibly damaging 0.72
R4749:Prob1 UTSW 18 35,785,869 (GRCm39) missense possibly damaging 0.91
R4968:Prob1 UTSW 18 35,785,605 (GRCm39) missense probably damaging 0.98
R5107:Prob1 UTSW 18 35,785,989 (GRCm39) missense possibly damaging 0.53
R5602:Prob1 UTSW 18 35,787,079 (GRCm39) missense possibly damaging 0.96
R5646:Prob1 UTSW 18 35,787,167 (GRCm39) missense probably benign 0.18
R6035:Prob1 UTSW 18 35,787,835 (GRCm39) missense probably benign 0.18
R6954:Prob1 UTSW 18 35,787,321 (GRCm39) missense probably benign
R7061:Prob1 UTSW 18 35,787,553 (GRCm39) missense probably benign 0.18
R7292:Prob1 UTSW 18 35,787,603 (GRCm39) missense possibly damaging 0.93
R7296:Prob1 UTSW 18 35,786,352 (GRCm39) missense possibly damaging 0.53
R7566:Prob1 UTSW 18 35,788,038 (GRCm39) missense probably benign 0.33
R7723:Prob1 UTSW 18 35,785,942 (GRCm39) missense possibly damaging 0.53
R7787:Prob1 UTSW 18 35,785,285 (GRCm39) missense possibly damaging 0.73
R7798:Prob1 UTSW 18 35,786,397 (GRCm39) missense possibly damaging 0.93
R8048:Prob1 UTSW 18 35,786,604 (GRCm39) missense probably benign 0.00
R8101:Prob1 UTSW 18 35,786,286 (GRCm39) missense possibly damaging 0.85
R8260:Prob1 UTSW 18 35,787,210 (GRCm39) missense possibly damaging 0.86
R8676:Prob1 UTSW 18 35,787,039 (GRCm39) missense possibly damaging 0.53
R9304:Prob1 UTSW 18 35,787,708 (GRCm39) missense probably damaging 1.00
R9440:Prob1 UTSW 18 35,786,218 (GRCm39) missense possibly damaging 0.53
X0067:Prob1 UTSW 18 35,786,144 (GRCm39) missense possibly damaging 0.70
Z1088:Prob1 UTSW 18 35,785,822 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATCTGACGTTTCGGCACAGTG -3'
(R):5'- TTAGGTTTCTCTGCTGCCAAG -3'

Sequencing Primer
(F):5'- TATTCTGGGCGCTGACGGAC -3'
(R):5'- AAGGCCGCTAGCTCAGG -3'
Posted On 2018-08-01