Incidental Mutation 'R6748:Cyp2j8'
ID530635
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96475545 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 294 (T294S)
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect probably benign
Transcript: ENSMUST00000124729
AA Change: T294S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932
AA Change: T294S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
cyprus UTSW 4 96499603 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1553:Cyp2j8 UTSW 4 96475557 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1632:Cyp2j8 UTSW 4 96447324 missense probably benign 0.02
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3123:Cyp2j8 UTSW 4 96501213 splice site probably benign
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5562:Cyp2j8 UTSW 4 96470653 missense probably damaging 1.00
R5596:Cyp2j8 UTSW 4 96507341 missense probably benign 0.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
R7975:Cyp2j8 UTSW 4 96470539 missense possibly damaging 0.65
R7993:Cyp2j8 UTSW 4 96447219 critical splice donor site probably null
R8878:Cyp2j8 UTSW 4 96470570 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GTTCTATCTTCTGGCCACATGTAAG -3'
(R):5'- CCAATTTCAAGACTTCGTTCTTGAG -3'

Sequencing Primer
(F):5'- GGCCACATGTAAGTAAAAATGTTCAG -3'
(R):5'- TAGCCTCTATCCAGGACAGATATGAG -3'
Posted On2018-08-01