Incidental Mutation 'R6748:Mtor'
ID530637
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148550184 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2421 (F2421L)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably damaging
Transcript: ENSMUST00000103221
AA Change: F2421L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: F2421L

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129715
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
R7697:Mtor UTSW 4 148540308 nonsense probably null
R7737:Mtor UTSW 4 148538738 missense possibly damaging 0.95
R7791:Mtor UTSW 4 148462940 missense probably benign 0.00
R7858:Mtor UTSW 4 148454646 missense probably damaging 1.00
R7941:Mtor UTSW 4 148454646 missense probably damaging 1.00
R8035:Mtor UTSW 4 148546399
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Z1176:Mtor UTSW 4 148550125
Z1176:Mtor UTSW 4 148550130
Predicted Primers PCR Primer
(F):5'- CAGGTCCCCAGTACTGTGTTAG -3'
(R):5'- AGAACTGCTCTGTAATTGTCAGG -3'

Sequencing Primer
(F):5'- GTCCCCAGTACTGTGTTAGAAATGAC -3'
(R):5'- ACTGCTCTGTAATTGTCAGGGACAC -3'
Posted On2018-08-01