Incidental Mutation 'R6748:Clec4a1'
ID530642
Institutional Source Beutler Lab
Gene Symbol Clec4a1
Ensembl Gene ENSMUSG00000049037
Gene NameC-type lectin domain family 4, member a1
SynonymsmDcir4
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122921848-122934619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122933897 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 237 (I237T)
Ref Sequence ENSEMBL: ENSMUSP00000062441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060484]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060484
AA Change: I237T

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062441
Gene: ENSMUSG00000049037
AA Change: I237T

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
CLECT 114 239 8.08e-29 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Clec4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Clec4a1 APN 6 122922055 missense possibly damaging 0.53
IGL00932:Clec4a1 APN 6 122930695 missense probably damaging 1.00
IGL01973:Clec4a1 APN 6 122930721 missense probably damaging 1.00
IGL01976:Clec4a1 APN 6 122928074 splice site probably benign
IGL02009:Clec4a1 APN 6 122932216 missense probably benign 0.09
IGL02629:Clec4a1 APN 6 122932147 critical splice acceptor site probably null
IGL03180:Clec4a1 APN 6 122924818 missense probably benign 0.08
R1973:Clec4a1 UTSW 6 122924834 splice site probably null
R4582:Clec4a1 UTSW 6 122932191 missense possibly damaging 0.58
R4758:Clec4a1 UTSW 6 122933866 missense probably damaging 0.97
R4937:Clec4a1 UTSW 6 122930695 missense probably damaging 1.00
R5362:Clec4a1 UTSW 6 122932237 missense probably damaging 1.00
R6247:Clec4a1 UTSW 6 122928042 missense probably benign 0.10
R7387:Clec4a1 UTSW 6 122922057 missense possibly damaging 0.91
R7481:Clec4a1 UTSW 6 122928039 missense probably damaging 1.00
R7733:Clec4a1 UTSW 6 122932150 missense possibly damaging 0.93
Z1177:Clec4a1 UTSW 6 122933892 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TATCCCTTTTCAAAGCATCACTGTG -3'
(R):5'- TAAATGGAAGGACCGGTTCC -3'

Sequencing Primer
(F):5'- GTGAGAATCACCTTCATCTTTTTCTC -3'
(R):5'- GAGGTACATAGTGAAACCCTGTCTC -3'
Posted On2018-08-01