Incidental Mutation 'R6748:Drd2'
ID530646
Institutional Source Beutler Lab
Gene Symbol Drd2
Ensembl Gene ENSMUSG00000032259
Gene Namedopamine receptor D2
SynonymsDrd-2, D2 receptor, D2R
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location49340627-49408177 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 49403202 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 244 (C244*)
Ref Sequence ENSEMBL: ENSMUSP00000075170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075764]
Predicted Effect probably null
Transcript: ENSMUST00000075764
AA Change: C244*
SMART Domains Protein: ENSMUSP00000075170
Gene: ENSMUSG00000032259
AA Change: C244*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 238 2.5e-15 PFAM
Pfam:7tm_1 51 427 1.2e-88 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D2 subtype of the dopamine receptor. This G-protein coupled receptor inhibits adenylyl cyclase activity. A missense mutation in this gene causes myoclonus dystonia; other mutations have been associated with schizophrenia. Alternative splicing of this gene results in two transcript variants encoding different isoforms. A third variant has been described, but it has not been determined whether this form is normal or due to aberrant splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show Parkinson's disease like symptoms, including akinetic and bradykinetic behavior. Mice lacking only the long isoform are hypoactive and exhibit increased sterotypic behavior in response to dopamine agonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Drd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Drd2 APN 9 49395758 missense probably damaging 1.00
IGL01407:Drd2 APN 9 49400815 missense probably damaging 1.00
IGL01669:Drd2 APN 9 49402089 missense possibly damaging 0.90
IGL02011:Drd2 APN 9 49406958 missense probably damaging 1.00
IGL02417:Drd2 APN 9 49402259 splice site probably benign
R0374:Drd2 UTSW 9 49399784 missense probably benign 0.41
R0402:Drd2 UTSW 9 49404971 missense probably benign 0.00
R0529:Drd2 UTSW 9 49407074 missense probably benign
R1124:Drd2 UTSW 9 49395640 missense probably damaging 0.98
R1458:Drd2 UTSW 9 49402212 missense probably damaging 1.00
R1807:Drd2 UTSW 9 49405067 missense probably damaging 1.00
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1971:Drd2 UTSW 9 49407059 missense probably damaging 1.00
R2192:Drd2 UTSW 9 49403271 missense probably benign 0.03
R2218:Drd2 UTSW 9 49399794 missense probably damaging 1.00
R3830:Drd2 UTSW 9 49402143 missense probably damaging 0.99
R4214:Drd2 UTSW 9 49404921 missense probably benign 0.00
R4595:Drd2 UTSW 9 49404789 missense probably benign 0.03
R5392:Drd2 UTSW 9 49395628 missense possibly damaging 0.80
R5415:Drd2 UTSW 9 49402253 missense possibly damaging 0.81
R5598:Drd2 UTSW 9 49407015 missense possibly damaging 0.94
R5646:Drd2 UTSW 9 49404912 missense probably benign
R5715:Drd2 UTSW 9 49404889 missense probably benign 0.00
R5901:Drd2 UTSW 9 49406959 nonsense probably null
R6365:Drd2 UTSW 9 49406949 missense probably damaging 1.00
R7017:Drd2 UTSW 9 49400829 missense probably benign 0.32
R7754:Drd2 UTSW 9 49404977 missense probably benign
X0022:Drd2 UTSW 9 49400781 missense probably damaging 1.00
Z1176:Drd2 UTSW 9 49395655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAGTGTACCAGCCTTCCC -3'
(R):5'- CTCTCAGCTGAAGCAAAGTAGG -3'

Sequencing Primer
(F):5'- AGTGTACCAGCCTTCCCTCTTG -3'
(R):5'- GAGACACTTCTCCCTTAAAATAGCTG -3'
Posted On2018-08-01