Incidental Mutation 'R6748:Clpx'
ID 530647
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Name caseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission 044865-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 65201542-65237940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65217441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 3 (N3S)
Ref Sequence ENSEMBL: ENSMUSP00000116377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]
AlphaFold Q9JHS4
Predicted Effect probably benign
Transcript: ENSMUST00000015501
AA Change: N175S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: N175S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113824
AA Change: N175S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: N175S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147279
AA Change: N3S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357
AA Change: N3S

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
AAA 100 192 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148632
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,574,327 (GRCm39) R178I probably damaging Het
Agr3 A G 12: 35,997,594 (GRCm39) probably null Het
Aoc1 C T 6: 48,883,228 (GRCm39) T368I possibly damaging Het
Aph1c A G 9: 66,740,577 (GRCm39) S50P probably damaging Het
Arhgap30 A G 1: 171,232,378 (GRCm39) E341G possibly damaging Het
Atp8b3 A T 10: 80,361,058 (GRCm39) M926K possibly damaging Het
C1qtnf9 A G 14: 61,017,276 (GRCm39) N269D probably damaging Het
Cdc42bpb T C 12: 111,261,273 (GRCm39) probably benign Het
Clec4a1 T C 6: 122,910,856 (GRCm39) I237T possibly damaging Het
Col19a1 A G 1: 24,573,151 (GRCm39) I207T unknown Het
Cyp2j8 T A 4: 96,363,782 (GRCm39) T294S probably benign Het
Dnah1 A G 14: 31,021,945 (GRCm39) I1186T probably damaging Het
Dnhd1 T G 7: 105,369,844 (GRCm39) V4423G probably benign Het
Dock4 A T 12: 40,754,465 (GRCm39) I485F probably benign Het
Drd2 T A 9: 49,314,502 (GRCm39) C244* probably null Het
Frmpd1 T A 4: 45,274,397 (GRCm39) I435K probably benign Het
Fzd5 A G 1: 64,774,723 (GRCm39) M346T possibly damaging Het
Gc T C 5: 89,583,431 (GRCm39) T371A probably benign Het
Gm12185 T A 11: 48,807,123 (GRCm39) T23S possibly damaging Het
Hbq1a A G 11: 32,250,169 (GRCm39) probably null Het
Herc1 TCCC TCC 9: 66,408,470 (GRCm39) probably null Het
Il1rap A T 16: 26,541,106 (GRCm39) N449I probably benign Het
Itgb5 T A 16: 33,719,667 (GRCm39) D279E probably damaging Het
Mat2b T A 11: 40,571,021 (GRCm39) I268F probably benign Het
Mtor T C 4: 148,634,641 (GRCm39) F2421L probably damaging Het
Myo5b G A 18: 74,834,574 (GRCm39) R878Q possibly damaging Het
Nkx2-6 A G 14: 69,412,555 (GRCm39) D241G probably benign Het
Or4f14 T A 2: 111,742,702 (GRCm39) N191I possibly damaging Het
Or5h23 T A 16: 58,906,253 (GRCm39) M198L probably benign Het
Pcdhb22 A C 18: 37,651,799 (GRCm39) D89A probably damaging Het
Pcnx2 C T 8: 126,577,074 (GRCm39) R986Q probably damaging Het
Plxna2 A G 1: 194,476,490 (GRCm39) probably null Het
Ppwd1 A T 13: 104,344,538 (GRCm39) Y527* probably null Het
Pramel35 T C 5: 94,000,072 (GRCm39) W38R probably benign Het
Rnf126 A G 10: 79,597,970 (GRCm39) L131P probably benign Het
Rsl1 T A 13: 67,330,688 (GRCm39) C379S probably benign Het
Sec23b A G 2: 144,408,714 (GRCm39) Y133C probably damaging Het
Slc25a24 T A 3: 109,056,823 (GRCm39) V112D possibly damaging Het
Slc35f3 A T 8: 127,121,377 (GRCm39) R413* probably null Het
Tas1r2 T C 4: 139,396,922 (GRCm39) F754L probably damaging Het
Tbc1d14 A G 5: 36,652,598 (GRCm39) S615P probably damaging Het
Ttc17 T C 2: 94,216,447 (GRCm39) K80R probably benign Het
Ttn T C 2: 76,576,428 (GRCm39) T24822A possibly damaging Het
Vmn1r222 C A 13: 23,417,117 (GRCm39) R32L probably benign Het
Zfp354b G A 11: 50,813,659 (GRCm39) T422M probably damaging Het
Zfp407 G A 18: 84,226,955 (GRCm39) T2218M probably damaging Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65,231,552 (GRCm39) missense probably damaging 1.00
IGL01394:Clpx APN 9 65,217,495 (GRCm39) missense probably damaging 1.00
IGL01395:Clpx APN 9 65,209,133 (GRCm39) missense probably benign 0.00
IGL01521:Clpx APN 9 65,226,026 (GRCm39) missense probably damaging 1.00
IGL02141:Clpx APN 9 65,219,400 (GRCm39) splice site probably null
IGL02512:Clpx APN 9 65,217,533 (GRCm39) missense probably benign
IGL03008:Clpx APN 9 65,230,057 (GRCm39) missense possibly damaging 0.76
IGL03146:Clpx APN 9 65,234,112 (GRCm39) missense probably benign 0.01
IGL03152:Clpx APN 9 65,217,458 (GRCm39) missense possibly damaging 0.56
IGL03309:Clpx APN 9 65,229,974 (GRCm39) missense probably damaging 1.00
kneehigh UTSW 9 65,209,161 (GRCm39) nonsense probably null
locust UTSW 9 65,231,583 (GRCm39) critical splice donor site probably null
IGL02837:Clpx UTSW 9 65,231,541 (GRCm39) missense probably damaging 1.00
R0167:Clpx UTSW 9 65,224,019 (GRCm39) missense possibly damaging 0.53
R0399:Clpx UTSW 9 65,230,051 (GRCm39) missense probably benign 0.03
R0666:Clpx UTSW 9 65,217,507 (GRCm39) missense probably damaging 1.00
R1386:Clpx UTSW 9 65,234,170 (GRCm39) missense probably null 0.88
R1594:Clpx UTSW 9 65,231,552 (GRCm39) missense probably damaging 0.99
R2038:Clpx UTSW 9 65,224,775 (GRCm39) missense probably damaging 1.00
R4131:Clpx UTSW 9 65,223,937 (GRCm39) missense possibly damaging 0.64
R4715:Clpx UTSW 9 65,219,396 (GRCm39) missense possibly damaging 0.92
R5107:Clpx UTSW 9 65,215,821 (GRCm39) missense possibly damaging 0.93
R5248:Clpx UTSW 9 65,228,132 (GRCm39) missense probably damaging 1.00
R5520:Clpx UTSW 9 65,224,730 (GRCm39) nonsense probably null
R5639:Clpx UTSW 9 65,237,112 (GRCm39) missense probably benign 0.00
R5718:Clpx UTSW 9 65,207,246 (GRCm39) missense probably benign
R6109:Clpx UTSW 9 65,207,234 (GRCm39) missense probably benign 0.02
R6172:Clpx UTSW 9 65,209,161 (GRCm39) nonsense probably null
R6173:Clpx UTSW 9 65,209,161 (GRCm39) nonsense probably null
R7287:Clpx UTSW 9 65,207,295 (GRCm39) nonsense probably null
R7409:Clpx UTSW 9 65,231,529 (GRCm39) missense possibly damaging 0.94
R7806:Clpx UTSW 9 65,207,213 (GRCm39) missense probably benign
R7814:Clpx UTSW 9 65,231,583 (GRCm39) critical splice donor site probably null
R8212:Clpx UTSW 9 65,228,173 (GRCm39) missense possibly damaging 0.46
R8753:Clpx UTSW 9 65,223,958 (GRCm39) missense probably damaging 1.00
R8939:Clpx UTSW 9 65,231,519 (GRCm39) missense probably benign 0.00
R9023:Clpx UTSW 9 65,234,115 (GRCm39) missense probably null 0.00
X0067:Clpx UTSW 9 65,223,977 (GRCm39) missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65,207,279 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCTGCTTGGGTAAATGAATAAC -3'
(R):5'- GCATAGTAATCTGCATTGTGGTC -3'

Sequencing Primer
(F):5'- GGTGCTGGGAACTAAACTCTAATCC -3'
(R):5'- AGTAATCTGCATTGTGGTCAATTAC -3'
Posted On 2018-08-01