Incidental Mutation 'R6748:Clpx'
ID530647
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Namecaseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location65294260-65330658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65310159 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3 (N3S)
Ref Sequence ENSEMBL: ENSMUSP00000116377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]
Predicted Effect probably benign
Transcript: ENSMUST00000015501
AA Change: N175S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: N175S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113824
AA Change: N175S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: N175S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147279
AA Change: N3S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357
AA Change: N3S

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
AAA 100 192 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148632
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65324270 missense probably damaging 1.00
IGL01394:Clpx APN 9 65310213 missense probably damaging 1.00
IGL01395:Clpx APN 9 65301851 missense probably benign 0.00
IGL01521:Clpx APN 9 65318744 missense probably damaging 1.00
IGL02141:Clpx APN 9 65312118 splice site probably null
IGL02512:Clpx APN 9 65310251 missense probably benign
IGL03008:Clpx APN 9 65322775 missense possibly damaging 0.76
IGL03146:Clpx APN 9 65326830 missense probably benign 0.01
IGL03152:Clpx APN 9 65310176 missense possibly damaging 0.56
IGL03309:Clpx APN 9 65322692 missense probably damaging 1.00
kneehigh UTSW 9 65301879 nonsense probably null
locust UTSW 9 65324301 critical splice donor site probably null
IGL02837:Clpx UTSW 9 65324259 missense probably damaging 1.00
R0167:Clpx UTSW 9 65316737 missense possibly damaging 0.53
R0399:Clpx UTSW 9 65322769 missense probably benign 0.03
R0666:Clpx UTSW 9 65310225 missense probably damaging 1.00
R1386:Clpx UTSW 9 65326888 missense probably null 0.88
R1594:Clpx UTSW 9 65324270 missense probably damaging 0.99
R2038:Clpx UTSW 9 65317493 missense probably damaging 1.00
R4131:Clpx UTSW 9 65316655 missense possibly damaging 0.64
R4715:Clpx UTSW 9 65312114 missense possibly damaging 0.92
R5107:Clpx UTSW 9 65308539 missense possibly damaging 0.93
R5248:Clpx UTSW 9 65320850 missense probably damaging 1.00
R5520:Clpx UTSW 9 65317448 nonsense probably null
R5639:Clpx UTSW 9 65329830 missense probably benign 0.00
R5718:Clpx UTSW 9 65299964 missense probably benign
R6109:Clpx UTSW 9 65299952 missense probably benign 0.02
R6172:Clpx UTSW 9 65301879 nonsense probably null
R6173:Clpx UTSW 9 65301879 nonsense probably null
R7287:Clpx UTSW 9 65300013 nonsense probably null
R7409:Clpx UTSW 9 65324247 missense possibly damaging 0.94
R7806:Clpx UTSW 9 65299931 missense probably benign
R7814:Clpx UTSW 9 65324301 critical splice donor site probably null
R8212:Clpx UTSW 9 65320891 missense possibly damaging 0.46
R8753:Clpx UTSW 9 65316676 missense probably damaging 1.00
X0067:Clpx UTSW 9 65316695 missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65299997 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCTGCTTGGGTAAATGAATAAC -3'
(R):5'- GCATAGTAATCTGCATTGTGGTC -3'

Sequencing Primer
(F):5'- GGTGCTGGGAACTAAACTCTAATCC -3'
(R):5'- AGTAATCTGCATTGTGGTCAATTAC -3'
Posted On2018-08-01