Incidental Mutation 'R6748:Zfp354b'
ID530655
Institutional Source Beutler Lab
Gene Symbol Zfp354b
Ensembl Gene ENSMUSG00000020335
Gene Namezinc finger protein 354B
SynonymsKid2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50921823-50931633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50922832 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 422 (T422M)
Ref Sequence ENSEMBL: ENSMUSP00000127671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109124] [ENSMUST00000164280]
Predicted Effect probably damaging
Transcript: ENSMUST00000109124
AA Change: T422M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104752
Gene: ENSMUSG00000020335
AA Change: T422M

DomainStartEndE-ValueType
KRAB 14 74 1.85e-36 SMART
ZnF_C2H2 206 228 4.47e-3 SMART
ZnF_C2H2 234 256 3.16e-3 SMART
ZnF_C2H2 262 284 7.37e-4 SMART
ZnF_C2H2 290 312 1.3e-4 SMART
ZnF_C2H2 343 365 1.47e-3 SMART
ZnF_C2H2 371 393 4.24e-4 SMART
ZnF_C2H2 399 421 2.79e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 2.4e-3 SMART
ZnF_C2H2 483 505 1.2e-3 SMART
ZnF_C2H2 511 533 3.95e-4 SMART
ZnF_C2H2 539 561 2.99e-4 SMART
ZnF_C2H2 567 589 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164280
AA Change: T422M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127671
Gene: ENSMUSG00000020335
AA Change: T422M

DomainStartEndE-ValueType
KRAB 14 74 1.85e-36 SMART
ZnF_C2H2 206 228 4.47e-3 SMART
ZnF_C2H2 234 256 3.16e-3 SMART
ZnF_C2H2 262 284 7.37e-4 SMART
ZnF_C2H2 290 312 1.3e-4 SMART
ZnF_C2H2 343 365 1.47e-3 SMART
ZnF_C2H2 371 393 4.24e-4 SMART
ZnF_C2H2 399 421 2.79e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 2.4e-3 SMART
ZnF_C2H2 483 505 1.2e-3 SMART
ZnF_C2H2 511 533 3.95e-4 SMART
ZnF_C2H2 539 561 2.99e-4 SMART
ZnF_C2H2 567 589 4.87e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Zfp354b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Zfp354b APN 11 50923837 missense probably benign
R1299:Zfp354b UTSW 11 50923470 missense probably benign 0.04
R1353:Zfp354b UTSW 11 50923413 missense probably damaging 0.96
R1860:Zfp354b UTSW 11 50923542 missense probably benign
R2072:Zfp354b UTSW 11 50922452 nonsense probably null
R5221:Zfp354b UTSW 11 50923090 missense probably benign 0.00
R5231:Zfp354b UTSW 11 50923090 missense probably benign 0.00
R5258:Zfp354b UTSW 11 50923090 missense probably benign 0.00
R5775:Zfp354b UTSW 11 50922820 missense probably benign 0.00
R5847:Zfp354b UTSW 11 50923216 missense probably damaging 0.96
R5929:Zfp354b UTSW 11 50922455 missense probably damaging 0.99
R6443:Zfp354b UTSW 11 50922754 missense possibly damaging 0.93
R7439:Zfp354b UTSW 11 50922397 missense probably damaging 1.00
R7706:Zfp354b UTSW 11 50928563 critical splice donor site probably null
R7819:Zfp354b UTSW 11 50923805 nonsense probably null
R7830:Zfp354b UTSW 11 50923309 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATGCAAATCTATGTTCAAGGCG -3'
(R):5'- TCCACGTCCCTTTCAGGA -3'

Sequencing Primer
(F):5'- CCCGCACGTGTTACATTTAAAGGG -3'
(R):5'- GACCTACTTGTGCAACGAATGTG -3'
Posted On2018-08-01