Incidental Mutation 'R6748:Agr3'
ID530656
Institutional Source Beutler Lab
Gene Symbol Agr3
Ensembl Gene ENSMUSG00000036231
Gene Nameanterior gradient 3
SynonymsLOC380754, E030025L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location35925620-35949736 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 35947595 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042101]
Predicted Effect probably null
Transcript: ENSMUST00000042101
SMART Domains Protein: ENSMUSP00000049212
Gene: ENSMUSG00000036231

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredox_DsbH 21 115 9.8e-10 PFAM
Pfam:Thioredoxin_7 42 123 3.9e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This gene is expressed in ciliated airway epithelial cells and, in mouse, plays a role in ciliary beat frequency in multiciliated cells. This gene is also over-expressed in breast, ovarian, and prostrate cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Itgb5 T A 16: 33,899,297 D279E probably damaging Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Agr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02902:Agr3 APN 12 35946916 missense probably damaging 0.99
R0031:Agr3 UTSW 12 35947591 missense probably benign 0.00
R0033:Agr3 UTSW 12 35928330 missense possibly damaging 0.68
R0033:Agr3 UTSW 12 35928330 missense possibly damaging 0.68
R0546:Agr3 UTSW 12 35928330 missense probably benign 0.37
R0963:Agr3 UTSW 12 35934434 missense probably benign 0.00
R1498:Agr3 UTSW 12 35934380 critical splice acceptor site probably null
R1619:Agr3 UTSW 12 35947859 splice site probably null
R3945:Agr3 UTSW 12 35947513 splice site probably benign
R3946:Agr3 UTSW 12 35947513 splice site probably benign
R4678:Agr3 UTSW 12 35947833 missense probably damaging 1.00
R5475:Agr3 UTSW 12 35947540 missense probably benign 0.00
R5750:Agr3 UTSW 12 35946942 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTTACACCCATGCCATTGAC -3'
(R):5'- CCCATCAGGTGACAAGTTCTTG -3'

Sequencing Primer
(F):5'- CCCATGCCATTGACACAATTATAG -3'
(R):5'- CGTGGTCTCATGCTAGCAGAAG -3'
Posted On2018-08-01