Incidental Mutation 'R6748:Dock4'
ID 530657
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 044865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R6748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40754465 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 485 (I485F)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: I485F

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: I485F

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: I485F

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,574,327 (GRCm39) R178I probably damaging Het
Agr3 A G 12: 35,997,594 (GRCm39) probably null Het
Aoc1 C T 6: 48,883,228 (GRCm39) T368I possibly damaging Het
Aph1c A G 9: 66,740,577 (GRCm39) S50P probably damaging Het
Arhgap30 A G 1: 171,232,378 (GRCm39) E341G possibly damaging Het
Atp8b3 A T 10: 80,361,058 (GRCm39) M926K possibly damaging Het
C1qtnf9 A G 14: 61,017,276 (GRCm39) N269D probably damaging Het
Cdc42bpb T C 12: 111,261,273 (GRCm39) probably benign Het
Clec4a1 T C 6: 122,910,856 (GRCm39) I237T possibly damaging Het
Clpx A G 9: 65,217,441 (GRCm39) N3S probably benign Het
Col19a1 A G 1: 24,573,151 (GRCm39) I207T unknown Het
Cyp2j8 T A 4: 96,363,782 (GRCm39) T294S probably benign Het
Dnah1 A G 14: 31,021,945 (GRCm39) I1186T probably damaging Het
Dnhd1 T G 7: 105,369,844 (GRCm39) V4423G probably benign Het
Drd2 T A 9: 49,314,502 (GRCm39) C244* probably null Het
Frmpd1 T A 4: 45,274,397 (GRCm39) I435K probably benign Het
Fzd5 A G 1: 64,774,723 (GRCm39) M346T possibly damaging Het
Gc T C 5: 89,583,431 (GRCm39) T371A probably benign Het
Gm12185 T A 11: 48,807,123 (GRCm39) T23S possibly damaging Het
Hbq1a A G 11: 32,250,169 (GRCm39) probably null Het
Herc1 TCCC TCC 9: 66,408,470 (GRCm39) probably null Het
Il1rap A T 16: 26,541,106 (GRCm39) N449I probably benign Het
Itgb5 T A 16: 33,719,667 (GRCm39) D279E probably damaging Het
Mat2b T A 11: 40,571,021 (GRCm39) I268F probably benign Het
Mtor T C 4: 148,634,641 (GRCm39) F2421L probably damaging Het
Myo5b G A 18: 74,834,574 (GRCm39) R878Q possibly damaging Het
Nkx2-6 A G 14: 69,412,555 (GRCm39) D241G probably benign Het
Or4f14 T A 2: 111,742,702 (GRCm39) N191I possibly damaging Het
Or5h23 T A 16: 58,906,253 (GRCm39) M198L probably benign Het
Pcdhb22 A C 18: 37,651,799 (GRCm39) D89A probably damaging Het
Pcnx2 C T 8: 126,577,074 (GRCm39) R986Q probably damaging Het
Plxna2 A G 1: 194,476,490 (GRCm39) probably null Het
Ppwd1 A T 13: 104,344,538 (GRCm39) Y527* probably null Het
Pramel35 T C 5: 94,000,072 (GRCm39) W38R probably benign Het
Rnf126 A G 10: 79,597,970 (GRCm39) L131P probably benign Het
Rsl1 T A 13: 67,330,688 (GRCm39) C379S probably benign Het
Sec23b A G 2: 144,408,714 (GRCm39) Y133C probably damaging Het
Slc25a24 T A 3: 109,056,823 (GRCm39) V112D possibly damaging Het
Slc35f3 A T 8: 127,121,377 (GRCm39) R413* probably null Het
Tas1r2 T C 4: 139,396,922 (GRCm39) F754L probably damaging Het
Tbc1d14 A G 5: 36,652,598 (GRCm39) S615P probably damaging Het
Ttc17 T C 2: 94,216,447 (GRCm39) K80R probably benign Het
Ttn T C 2: 76,576,428 (GRCm39) T24822A possibly damaging Het
Vmn1r222 C A 13: 23,417,117 (GRCm39) R32L probably benign Het
Zfp354b G A 11: 50,813,659 (GRCm39) T422M probably damaging Het
Zfp407 G A 18: 84,226,955 (GRCm39) T2218M probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGAACCTGCCTTTAACTCACATG -3'
(R):5'- AAATTACAGTGACTCCCTGGAC -3'

Sequencing Primer
(F):5'- TGCCTTTAACTCACATGTTTCTTC -3'
(R):5'- CTTTCAAAGCTTCTCTAGGAGTCAGG -3'
Posted On 2018-08-01