Mutagenetix > Incidental Mutation

Incidental Mutation 'R6748:Cdc42bpb'

530658

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpb

Ensembl Gene

ENSMUSG00000021279

Gene Name

CDC42 binding protein kinase beta

Synonyms

DMPK-like

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.703) question?

Stock #

R6748 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

111292976-111377718 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 111294839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041965] [ENSMUST00000220657]

AlphaFold

Q7TT50

Predicted Effect

probably benign
Transcript: ENSMUST00000041965

SMART Domains

Protein: ENSMUSP00000042565
Gene: ENSMUSG00000021279

Domain	Start	End	E-Value	Type
S_TKc	76	342	1e-87	SMART
S_TK_X	343	405	5.02e-10	SMART
Pfam:KELK	527	606	4.5e-32	PFAM
low complexity region	628	640	N/A	INTRINSIC
coiled coil region	727	815	N/A	INTRINSIC
low complexity region	843	859	N/A	INTRINSIC
Pfam:DMPK_coil	878	939	1.2e-29	PFAM
C1	1027	1076	1.43e-11	SMART
PH	1097	1217	1.19e-6	SMART
CNH	1240	1521	1.32e-10	SMART
low complexity region	1564	1576	N/A	INTRINSIC
PBD	1585	1620	7.16e-10	SMART
low complexity region	1681	1696	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181055

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220619

Predicted Effect

unknown
Transcript: ENSMUST00000220657
AA Change: T179A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222483

Predicted Effect

probably benign
Transcript: ENSMUST00000222724

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff3	C	A	1: 38,535,246	R178I	probably damaging	Het
Agr3	A	G	12: 35,947,595		probably null	Het
Aoc1	C	T	6: 48,906,294	T368I	possibly damaging	Het
Aph1c	A	G	9: 66,833,295	S50P	probably damaging	Het
Arhgap30	A	G	1: 171,404,810	E341G	possibly damaging	Het
Atp8b3	A	T	10: 80,525,224	M926K	possibly damaging	Het
C1qtnf9	A	G	14: 60,779,827	N269D	probably damaging	Het
Clec4a1	T	C	6: 122,933,897	I237T	possibly damaging	Het
Clpx	A	G	9: 65,310,159	N3S	probably benign	Het
Col19a1	A	G	1: 24,534,070	I207T	unknown	Het
Cyp2j8	T	A	4: 96,475,545	T294S	probably benign	Het
Dnah1	A	G	14: 31,299,988	I1186T	probably damaging	Het
Dnhd1	T	G	7: 105,720,637	V4423G	probably benign	Het
Dock4	A	T	12: 40,704,466	I485F	probably benign	Het
Drd2	T	A	9: 49,403,202	C244*	probably null	Het
Frmpd1	T	A	4: 45,274,397	I435K	probably benign	Het
Fzd5	A	G	1: 64,735,564	M346T	possibly damaging	Het
Gc	T	C	5: 89,435,572	T371A	probably benign	Het
Gm12185	T	A	11: 48,916,296	T23S	possibly damaging	Het
Gm7792	T	C	5: 93,852,213	W38R	probably benign	Het
Hbq1a	A	G	11: 32,300,169		probably null	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Il1rap	A	T	16: 26,722,356	N449I	probably benign	Het
Itgb5	T	A	16: 33,899,297	D279E	probably damaging	Het
Mat2b	T	A	11: 40,680,194	I268F	probably benign	Het
Mtor	T	C	4: 148,550,184	F2421L	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Nkx2-6	A	G	14: 69,175,106	D241G	probably benign	Het
Olfr1306	T	A	2: 111,912,357	N191I	possibly damaging	Het
Olfr191	T	A	16: 59,085,890	M198L	probably benign	Het
Pcdhb22	A	C	18: 37,518,746	D89A	probably damaging	Het
Pcnx2	C	T	8: 125,850,335	R986Q	probably damaging	Het
Plxna2	A	G	1: 194,794,182		probably null	Het
Ppwd1	A	T	13: 104,208,030	Y527*	probably null	Het
Rnf126	A	G	10: 79,762,136	L131P	probably benign	Het
Rsl1	T	A	13: 67,182,624	C379S	probably benign	Het
Sec23b	A	G	2: 144,566,794	Y133C	probably damaging	Het
Slc25a24	T	A	3: 109,149,507	V112D	possibly damaging	Het
Slc35f3	A	T	8: 126,394,638	R413*	probably null	Het
Tas1r2	T	C	4: 139,669,611	F754L	probably damaging	Het
Tbc1d14	A	G	5: 36,495,254	S615P	probably damaging	Het
Ttc17	T	C	2: 94,386,102	K80R	probably benign	Het
Ttn	T	C	2: 76,746,084	T24822A	possibly damaging	Het
Vmn1r222	C	A	13: 23,232,947	R32L	probably benign	Het
Zfp354b	G	A	11: 50,922,832	T422M	probably damaging	Het
Zfp407	G	A	18: 84,208,830	T2218M	probably damaging	Het

Other mutations in Cdc42bpb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Cdc42bpb	APN	12	111294096	unclassified	probably benign
IGL01360:Cdc42bpb	APN	12	111342075	missense	probably damaging	1.00
IGL01577:Cdc42bpb	APN	12	111302043	missense	possibly damaging	0.71
IGL01909:Cdc42bpb	APN	12	111323142	missense	probably benign
IGL01924:Cdc42bpb	APN	12	111317453	unclassified	probably benign
IGL02428:Cdc42bpb	APN	12	111323127	missense	probably benign
IGL02678:Cdc42bpb	APN	12	111326096	missense	probably damaging	1.00
IGL02792:Cdc42bpb	APN	12	111299561	missense	probably benign
IGL03367:Cdc42bpb	APN	12	111336159	missense	probably damaging	1.00
F5770:Cdc42bpb	UTSW	12	111296391	missense	probably benign	0.28
PIT4585001:Cdc42bpb	UTSW	12	111304978	missense	probably damaging	1.00
R0129:Cdc42bpb	UTSW	12	111304959	intron	probably benign
R0633:Cdc42bpb	UTSW	12	111345555	missense	probably damaging	0.99
R1054:Cdc42bpb	UTSW	12	111313353	missense	probably benign	0.00
R1335:Cdc42bpb	UTSW	12	111296441	missense	probably damaging	1.00
R1459:Cdc42bpb	UTSW	12	111296300	unclassified	probably benign
R1780:Cdc42bpb	UTSW	12	111322907	missense	probably damaging	1.00
R1823:Cdc42bpb	UTSW	12	111327559	missense	probably damaging	1.00
R1843:Cdc42bpb	UTSW	12	111322821	missense	probably benign
R1902:Cdc42bpb	UTSW	12	111326016	missense	probably damaging	1.00
R1945:Cdc42bpb	UTSW	12	111299133	missense	probably damaging	1.00
R2077:Cdc42bpb	UTSW	12	111299196	missense	probably damaging	1.00
R2184:Cdc42bpb	UTSW	12	111296044	missense	probably damaging	0.99
R2208:Cdc42bpb	UTSW	12	111336029	missense	probably damaging	1.00
R2211:Cdc42bpb	UTSW	12	111301854	missense	probably benign	0.11
R2273:Cdc42bpb	UTSW	12	111302167	missense	probably damaging	1.00
R2406:Cdc42bpb	UTSW	12	111302124	missense	probably benign	0.00
R3080:Cdc42bpb	UTSW	12	111295818	missense	probably damaging	0.99
R3612:Cdc42bpb	UTSW	12	111303822	intron	probably benign
R4106:Cdc42bpb	UTSW	12	111295145	missense	probably benign	0.01
R4133:Cdc42bpb	UTSW	12	111321542	missense	probably benign	0.00
R4156:Cdc42bpb	UTSW	12	111294139	missense	probably benign	0.17
R4202:Cdc42bpb	UTSW	12	111294139	missense	probably benign	0.17
R4573:Cdc42bpb	UTSW	12	111323141	missense	probably benign	0.00
R4659:Cdc42bpb	UTSW	12	111339891	missense	probably damaging	1.00
R5101:Cdc42bpb	UTSW	12	111299115	missense	probably damaging	1.00
R5591:Cdc42bpb	UTSW	12	111323087	missense	probably benign	0.01
R5669:Cdc42bpb	UTSW	12	111302013	critical splice donor site	probably null
R5830:Cdc42bpb	UTSW	12	111345582	nonsense	probably null
R5872:Cdc42bpb	UTSW	12	111325976	missense	probably damaging	1.00
R6813:Cdc42bpb	UTSW	12	111327615	missense	probably damaging	1.00
R7024:Cdc42bpb	UTSW	12	111326085	missense	probably damaging	1.00
R7165:Cdc42bpb	UTSW	12	111321517	missense	probably damaging	1.00
R7228:Cdc42bpb	UTSW	12	111305093	missense	possibly damaging	0.92
R7258:Cdc42bpb	UTSW	12	111326084	missense	probably damaging	1.00
R7352:Cdc42bpb	UTSW	12	111299311	missense	probably damaging	1.00
R7361:Cdc42bpb	UTSW	12	111345605	missense	probably damaging	1.00
R7399:Cdc42bpb	UTSW	12	111305667	missense	probably benign	0.00
R7468:Cdc42bpb	UTSW	12	111339873	missense	probably damaging	1.00
R7622:Cdc42bpb	UTSW	12	111294772	missense	unknown
R7648:Cdc42bpb	UTSW	12	111377153	missense	probably damaging	1.00
R7734:Cdc42bpb	UTSW	12	111329230	missense	probably damaging	1.00
R7783:Cdc42bpb	UTSW	12	111336025	critical splice donor site	probably null
R8738:Cdc42bpb	UTSW	12	111307787	missense	probably benign	0.42
R9111:Cdc42bpb	UTSW	12	111318469	missense	probably benign
R9168:Cdc42bpb	UTSW	12	111320083	missense	possibly damaging	0.65
R9506:Cdc42bpb	UTSW	12	111294938	missense	probably benign	0.00
R9510:Cdc42bpb	UTSW	12	111294938	missense	probably benign	0.00
R9511:Cdc42bpb	UTSW	12	111294938	missense	probably benign	0.00
R9542:Cdc42bpb	UTSW	12	111302074	nonsense	probably null
R9563:Cdc42bpb	UTSW	12	111299328	missense	possibly damaging	0.80
R9758:Cdc42bpb	UTSW	12	111299349	missense	possibly damaging	0.65
V7582:Cdc42bpb	UTSW	12	111296391	missense	probably benign	0.28
V7583:Cdc42bpb	UTSW	12	111296391	missense	probably benign	0.28
X0023:Cdc42bpb	UTSW	12	111326078	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAACCTTGATCACACTGTTG -3'
(R):5'- CATTCATCATGATCCTCTGGGC -3'

Sequencing Primer
(F):5'- GAGGACCCTGGGCTGCC -3'
(R):5'- ATCATGATCCTCTGGGCCTCTC -3'

Posted On

2018-08-01