Incidental Mutation 'R6748:Itgb5'
ID530666
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Nameintegrin beta 5
SynonymsESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6748 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33829665-33949338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33899297 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 279 (D279E)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]
Predicted Effect probably damaging
Transcript: ENSMUST00000069345
AA Change: D279E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: D279E

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115028
AA Change: D279E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: D279E

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148462
Predicted Effect probably benign
Transcript: ENSMUST00000232262
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C A 1: 38,535,246 R178I probably damaging Het
Agr3 A G 12: 35,947,595 probably null Het
Aoc1 C T 6: 48,906,294 T368I possibly damaging Het
Aph1c A G 9: 66,833,295 S50P probably damaging Het
Arhgap30 A G 1: 171,404,810 E341G possibly damaging Het
Atp8b3 A T 10: 80,525,224 M926K possibly damaging Het
C1qtnf9 A G 14: 60,779,827 N269D probably damaging Het
Cdc42bpb T C 12: 111,294,839 probably benign Het
Clec4a1 T C 6: 122,933,897 I237T possibly damaging Het
Clpx A G 9: 65,310,159 N3S probably benign Het
Col19a1 A G 1: 24,534,070 I207T unknown Het
Cyp2j8 T A 4: 96,475,545 T294S probably benign Het
Dnah1 A G 14: 31,299,988 I1186T probably damaging Het
Dnhd1 T G 7: 105,720,637 V4423G probably benign Het
Dock4 A T 12: 40,704,466 I485F probably benign Het
Drd2 T A 9: 49,403,202 C244* probably null Het
Frmpd1 T A 4: 45,274,397 I435K probably benign Het
Fzd5 A G 1: 64,735,564 M346T possibly damaging Het
Gc T C 5: 89,435,572 T371A probably benign Het
Gm12185 T A 11: 48,916,296 T23S possibly damaging Het
Gm7792 T C 5: 93,852,213 W38R probably benign Het
Hbq1a A G 11: 32,300,169 probably null Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Il1rap A T 16: 26,722,356 N449I probably benign Het
Mat2b T A 11: 40,680,194 I268F probably benign Het
Mtor T C 4: 148,550,184 F2421L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Nkx2-6 A G 14: 69,175,106 D241G probably benign Het
Olfr1306 T A 2: 111,912,357 N191I possibly damaging Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Pcdhb22 A C 18: 37,518,746 D89A probably damaging Het
Pcnx2 C T 8: 125,850,335 R986Q probably damaging Het
Plxna2 A G 1: 194,794,182 probably null Het
Ppwd1 A T 13: 104,208,030 Y527* probably null Het
Rnf126 A G 10: 79,762,136 L131P probably benign Het
Rsl1 T A 13: 67,182,624 C379S probably benign Het
Sec23b A G 2: 144,566,794 Y133C probably damaging Het
Slc25a24 T A 3: 109,149,507 V112D possibly damaging Het
Slc35f3 A T 8: 126,394,638 R413* probably null Het
Tas1r2 T C 4: 139,669,611 F754L probably damaging Het
Tbc1d14 A G 5: 36,495,254 S615P probably damaging Het
Ttc17 T C 2: 94,386,102 K80R probably benign Het
Ttn T C 2: 76,746,084 T24822A possibly damaging Het
Vmn1r222 C A 13: 23,232,947 R32L probably benign Het
Zfp354b G A 11: 50,922,832 T422M probably damaging Het
Zfp407 G A 18: 84,208,830 T2218M probably damaging Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGTGAGAAGCCCTGATGCTG -3'
(R):5'- AATTACTGCAGGTGAGGAGGTTTC -3'

Sequencing Primer
(F):5'- GGACACAGCTCTCACTTAGACTTGG -3'
(R):5'- GTTTCCAGGTAAGGGATGAGC -3'
Posted On2018-08-01