Incidental Mutation 'R6750:Gm597'
ID 530671
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission 044867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6750 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 28777414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 512 (E512D)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably damaging
Transcript: ENSMUST00000059937
AA Change: E512D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: E512D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 (GRCm38) S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 (GRCm38) probably benign Het
Adal A T 2: 121,142,649 (GRCm38) L62F probably damaging Het
Akap13 C T 7: 75,739,458 (GRCm38) P2375S probably benign Het
Apob T A 12: 7,997,853 (GRCm38) L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 (GRCm38) V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 (GRCm38) I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 (GRCm38) L86P unknown Het
Churc1 C A 12: 76,775,631 (GRCm38) H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 (GRCm38) L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 (GRCm38) G178E possibly damaging Het
Cmah A G 13: 24,464,252 (GRCm38) Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 (GRCm38) S357L probably damaging Het
Col6a6 A G 9: 105,783,680 (GRCm38) I410T probably damaging Het
Crmp1 T C 5: 37,265,322 (GRCm38) probably null Het
Csmd2 A C 4: 128,197,225 (GRCm38) N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 (GRCm38) M56L probably benign Het
D2hgdh G C 1: 93,826,407 (GRCm38) R56P probably benign Het
Dapk2 A G 9: 66,220,752 (GRCm38) E104G probably damaging Het
Dld T C 12: 31,332,214 (GRCm38) N498S probably benign Het
Dyrk4 G T 6: 126,898,955 (GRCm38) Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 (GRCm38) I333V probably damaging Het
F5 A G 1: 164,193,507 (GRCm38) T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 (GRCm38) G102D probably damaging Het
Foxa1 C T 12: 57,542,610 (GRCm38) G275R probably benign Het
Fryl A G 5: 73,022,232 (GRCm38) I2944T probably damaging Het
Gna15 T C 10: 81,514,283 (GRCm38) D95G probably benign Het
Greb1 T A 12: 16,688,583 (GRCm38) M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 (GRCm38) probably null Het
Herc2 T C 7: 56,097,447 (GRCm38) I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 (GRCm38) M366K probably benign Het
Krt27 C T 11: 99,348,980 (GRCm38) E253K probably damaging Het
Micalcl C T 7: 112,381,839 (GRCm38) T406I probably damaging Het
Mocs2 T G 13: 114,826,248 (GRCm38) D156E probably damaging Het
Mprip A T 11: 59,696,131 (GRCm38) K43N probably damaging Het
Myo5b A T 18: 74,617,035 (GRCm38) T190S possibly damaging Het
Naa25 C T 5: 121,408,309 (GRCm38) T86M probably damaging Het
Ncam1 T C 9: 49,567,339 (GRCm38) D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 (GRCm38) Y908* probably null Het
Nlrp9b T A 7: 20,023,234 (GRCm38) L132* probably null Het
Nrg1 A C 8: 31,818,096 (GRCm38) S679A probably damaging Het
Olfr3 C A 2: 36,812,942 (GRCm38) R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 (GRCm38) R145C probably damaging Het
Paqr9 A T 9: 95,560,997 (GRCm38) T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 (GRCm38) L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 (GRCm38) D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 (GRCm38) S17T unknown Het
Plcz1 T C 6: 140,028,438 (GRCm38) K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 (GRCm38) R126P probably damaging Het
Prkg1 C T 19: 31,764,561 (GRCm38) E88K probably benign Het
Psme4 A T 11: 30,853,203 (GRCm38) D15V probably damaging Het
Ptprf A G 4: 118,231,731 (GRCm38) V625A probably benign Het
Rab27a G A 9: 73,085,008 (GRCm38) S106N probably damaging Het
Rasa4 A G 5: 136,100,948 (GRCm38) T261A probably benign Het
Sardh T C 2: 27,228,257 (GRCm38) D487G probably benign Het
Sec16a A G 2: 26,440,018 (GRCm38) Y662H probably benign Het
Sema3d T A 5: 12,585,100 (GRCm38) L711* probably null Het
Sept14 T A 5: 129,696,117 (GRCm38) Y152F probably damaging Het
Smc5 A G 19: 23,242,640 (GRCm38) L411P probably damaging Het
Spg7 T A 8: 123,073,911 (GRCm38) V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 (GRCm38) probably benign Het
Tle1 A T 4: 72,122,450 (GRCm38) I631N probably damaging Het
Tmed3 T A 9: 89,699,790 (GRCm38) S207C probably damaging Het
Tmem59l G A 8: 70,486,372 (GRCm38) P51S probably benign Het
Trpc3 A G 3: 36,624,393 (GRCm38) Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 (GRCm38) F66S probably damaging Het
Ttll5 T A 12: 85,956,610 (GRCm38) S216R probably damaging Het
Usp22 A T 11: 61,157,216 (GRCm38) V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 (GRCm38) N621S probably damaging Het
Wdr75 A G 1: 45,817,379 (GRCm38) T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 (GRCm38) D173E probably damaging Het
Zfp317 G A 9: 19,647,804 (GRCm38) G438D probably damaging Het
Zscan10 T A 17: 23,607,190 (GRCm38) S109T possibly damaging Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28,778,651 (GRCm38) missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28,776,845 (GRCm38) missense unknown
IGL01296:Gm597 APN 1 28,777,056 (GRCm38) missense probably benign 0.23
IGL01476:Gm597 APN 1 28,777,453 (GRCm38) missense probably benign 0.04
IGL02125:Gm597 APN 1 28,776,338 (GRCm38) missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28,778,631 (GRCm38) missense probably benign 0.25
IGL02982:Gm597 APN 1 28,778,054 (GRCm38) missense probably damaging 1.00
IGL03031:Gm597 APN 1 28,778,583 (GRCm38) missense probably benign 0.03
IGL03267:Gm597 APN 1 28,777,121 (GRCm38) missense probably damaging 1.00
R0294:Gm597 UTSW 1 28,778,663 (GRCm38) missense probably benign 0.00
R0433:Gm597 UTSW 1 28,777,342 (GRCm38) nonsense probably null
R0485:Gm597 UTSW 1 28,778,142 (GRCm38) missense probably damaging 1.00
R0645:Gm597 UTSW 1 28,776,930 (GRCm38) missense probably damaging 0.99
R0744:Gm597 UTSW 1 28,777,821 (GRCm38) missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28,777,821 (GRCm38) missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28,777,802 (GRCm38) missense probably benign 0.01
R1302:Gm597 UTSW 1 28,776,340 (GRCm38) missense probably benign 0.00
R1394:Gm597 UTSW 1 28,776,809 (GRCm38) missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28,776,809 (GRCm38) missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28,778,748 (GRCm38) missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28,777,424 (GRCm38) missense probably damaging 1.00
R2004:Gm597 UTSW 1 28,777,179 (GRCm38) missense probably damaging 1.00
R2021:Gm597 UTSW 1 28,778,153 (GRCm38) missense probably damaging 0.98
R2022:Gm597 UTSW 1 28,778,153 (GRCm38) missense probably damaging 0.98
R3115:Gm597 UTSW 1 28,776,329 (GRCm38) missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28,776,575 (GRCm38) missense probably benign 0.26
R3616:Gm597 UTSW 1 28,776,575 (GRCm38) missense probably benign 0.26
R3862:Gm597 UTSW 1 28,777,641 (GRCm38) missense probably damaging 0.98
R4067:Gm597 UTSW 1 28,777,631 (GRCm38) missense probably damaging 0.98
R4119:Gm597 UTSW 1 28,777,973 (GRCm38) missense probably damaging 0.99
R4415:Gm597 UTSW 1 28,777,133 (GRCm38) missense probably benign 0.01
R5010:Gm597 UTSW 1 28,777,862 (GRCm38) missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28,777,555 (GRCm38) missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28,780,060 (GRCm38) missense probably benign 0.00
R5533:Gm597 UTSW 1 28,778,082 (GRCm38) missense probably damaging 1.00
R6085:Gm597 UTSW 1 28,778,227 (GRCm38) missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28,778,699 (GRCm38) missense probably benign 0.01
R6757:Gm597 UTSW 1 28,780,110 (GRCm38) missense probably damaging 0.98
R6774:Gm597 UTSW 1 28,776,893 (GRCm38) missense probably benign 0.00
R7156:Gm597 UTSW 1 28,776,767 (GRCm38) missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28,780,152 (GRCm38) missense probably benign 0.04
R7739:Gm597 UTSW 1 28,777,608 (GRCm38) missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28,778,406 (GRCm38) missense probably damaging 0.98
R8082:Gm597 UTSW 1 28,777,498 (GRCm38) missense probably benign 0.08
R8281:Gm597 UTSW 1 28,778,144 (GRCm38) missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28,778,505 (GRCm38) missense probably damaging 1.00
R8944:Gm597 UTSW 1 28,777,074 (GRCm38) missense probably benign 0.00
R9042:Gm597 UTSW 1 28,776,956 (GRCm38) missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28,776,659 (GRCm38) missense probably benign 0.04
R9106:Gm597 UTSW 1 28,776,894 (GRCm38) missense probably benign 0.00
R9173:Gm597 UTSW 1 28,777,349 (GRCm38) missense probably benign 0.22
R9596:Gm597 UTSW 1 28,776,607 (GRCm38) missense probably benign 0.07
R9632:Gm597 UTSW 1 28,778,039 (GRCm38) missense probably benign 0.20
R9656:Gm597 UTSW 1 28,777,455 (GRCm38) missense probably benign 0.02
R9659:Gm597 UTSW 1 28,777,455 (GRCm38) missense probably benign 0.02
R9661:Gm597 UTSW 1 28,777,455 (GRCm38) missense probably benign 0.02
R9663:Gm597 UTSW 1 28,777,455 (GRCm38) missense probably benign 0.02
R9710:Gm597 UTSW 1 28,778,039 (GRCm38) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCCTGAAACCACATGCTCAG -3'
(R):5'- TGAACAGCATGCAGTTTCCC -3'

Sequencing Primer
(F):5'- AGACATCTTCCATGGTGCATG -3'
(R):5'- TTTCCCGAGAAACACAGAATATTGC -3'
Posted On 2018-08-01